Incidental Mutation 'R1748:Map3k8'
ID194165
Institutional Source Beutler Lab
Gene Symbol Map3k8
Ensembl Gene ENSMUSG00000024235
Gene Namemitogen-activated protein kinase kinase kinase 8
SynonymsTpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
MMRRC Submission 039780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1748 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4331327-4353015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4334766 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 293 (Y293H)
Ref Sequence ENSEMBL: ENSMUSP00000025078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025078] [ENSMUST00000173930]
Predicted Effect probably damaging
Transcript: ENSMUST00000025078
AA Change: Y293H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: Y293H

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173708
Predicted Effect probably benign
Transcript: ENSMUST00000173930
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,333,588 Q1403K probably benign Het
Adamts12 G A 15: 11,241,462 M373I probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aire T C 10: 78,043,480 H15R probably damaging Het
Aldh3b2 T C 19: 3,977,572 F38L probably damaging Het
Alk A C 17: 72,603,421 C97G probably benign Het
Ano8 T C 8: 71,478,958 probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arsk T A 13: 76,062,410 H506L probably benign Het
Asgr2 G T 11: 70,096,832 R52L probably damaging Het
Atp2a1 A G 7: 126,459,608 I145T possibly damaging Het
Atrnl1 A G 19: 57,714,702 T1051A probably damaging Het
Cacna1e A T 1: 154,486,569 V424D possibly damaging Het
Capn3 T C 2: 120,497,013 V574A probably benign Het
Capzb C A 4: 139,257,368 D67E probably damaging Het
Ccdc68 A T 18: 69,955,991 T202S probably benign Het
Ccser2 T A 14: 36,896,314 K123* probably null Het
Ccser2 T C 14: 36,896,313 K123R probably damaging Het
Ces2h T C 8: 105,017,841 I316T probably benign Het
Chd3 T G 11: 69,364,697 K122Q possibly damaging Het
Col12a1 T C 9: 79,672,997 T1533A probably benign Het
Cr2 T A 1: 195,155,905 K1084* probably null Het
Ddx28 A G 8: 106,010,682 L248P probably benign Het
Depdc5 A G 5: 32,917,942 E488G probably benign Het
Dld T C 12: 31,334,746 T305A probably benign Het
Dok5 T A 2: 170,841,453 F211L probably damaging Het
Duox2 T C 2: 122,287,051 D934G probably benign Het
Eif3a G A 19: 60,766,798 T982I unknown Het
Erbb2 G T 11: 98,435,335 R979L probably benign Het
Espl1 G T 15: 102,298,529 V143L possibly damaging Het
Fanci T C 7: 79,430,488 L598P probably damaging Het
Fat2 T A 11: 55,256,647 E3923V probably damaging Het
Fhod3 A T 18: 24,770,493 K95* probably null Het
Gm16286 T C 18: 80,211,946 S152P probably benign Het
Gm7534 C G 4: 134,200,299 C381S probably damaging Het
Gm7534 T A 4: 134,202,119 T292S possibly damaging Het
Gpr108 G T 17: 57,236,217 T484K probably damaging Het
Hao1 T A 2: 134,498,318 N351I possibly damaging Het
Hepacam A T 9: 37,383,893 N308I possibly damaging Het
Herc2 T C 7: 56,148,823 probably null Het
Hltf T C 3: 20,076,521 I301T probably benign Het
Igsf10 A T 3: 59,319,093 N2386K probably damaging Het
Ikbke G T 1: 131,259,200 T585K probably benign Het
Iqgap3 A G 3: 88,113,980 T448A possibly damaging Het
Kl T C 5: 150,980,985 S401P possibly damaging Het
Lama4 T C 10: 39,065,619 V684A probably benign Het
Lgals8 A T 13: 12,454,943 F45Y probably damaging Het
Lgalsl G A 11: 20,826,491 R134C probably benign Het
Lmcd1 T C 6: 112,329,914 V349A probably benign Het
Lrp1b T A 2: 41,728,706 N119Y possibly damaging Het
Lrrc73 T A 17: 46,255,695 I157N probably damaging Het
Mybphl A T 3: 108,375,084 probably null Het
Ndrg1 A G 15: 66,931,081 M140T possibly damaging Het
Olfr138 T A 17: 38,275,106 C112S possibly damaging Het
Olfr885 A G 9: 38,061,500 Y60C probably damaging Het
Pbx2 T C 17: 34,593,977 S76P possibly damaging Het
Plcl2 T A 17: 50,606,798 S278R probably benign Het
Polr3d A T 14: 70,439,475 L393* probably null Het
Prmt6 T C 3: 110,250,367 Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sag T A 1: 87,831,940 I300N probably damaging Het
Sap25 T A 5: 137,641,918 probably null Het
Scarb2 A G 5: 92,460,836 L177P probably damaging Het
Sh3pxd2b A T 11: 32,422,203 N457Y possibly damaging Het
Siae T A 9: 37,631,606 probably null Het
Slc36a1 T C 11: 55,228,324 L375P probably damaging Het
Smg8 A G 11: 87,085,768 V329A probably damaging Het
Tas2r113 A T 6: 132,893,732 Y241F probably damaging Het
Tm9sf3 T G 19: 41,256,229 S70R probably benign Het
Tmem144 C T 3: 79,825,287 S228N probably damaging Het
Tmem45a C A 16: 56,822,338 V157F possibly damaging Het
Tpbg G T 9: 85,844,376 V133L probably damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ube2c T C 2: 164,771,321 F53S probably damaging Het
Vmn1r78 T A 7: 12,153,323 V287D probably damaging Het
Vmn2r114 T A 17: 23,308,061 D499V probably benign Het
Other mutations in Map3k8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense possibly damaging 0.95
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCAGTTTGCATTCGAACAGCC -3'
(R):5'- AGAGAACGTGCTGGGATTTTCCTTG -3'

Sequencing Primer
(F):5'- CATTACCCTATCGTCTTGGTATGAGG -3'
(R):5'- CCTTGGCTTGAGGGATACTGC -3'
Posted On2014-05-23