Incidental Mutation 'R1749:Fgfr4'
ID194218
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 55167792 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452] [ENSMUST00000005452]
Predicted Effect probably null
Transcript: ENSMUST00000005452
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000005452
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACTGCCCCTCAGAGCTGTAAG -3'
(R):5'- GTACTGCAAGGAACAGAGCTGGTC -3'

Sequencing Primer
(F):5'- AGTGGTCAGACCTCATCTGC -3'
(R):5'- ACAGGATGCTTCGTGTTCATATC -3'
Posted On2014-05-23