Incidental Mutation 'R0035:Ptprk'
ID19423
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0035 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 28263508 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 76 (Y76*)
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably null
Transcript: ENSMUST00000166468
AA Change: Y76*
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: Y76*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218276
AA Change: Y76*
Predicted Effect probably null
Transcript: ENSMUST00000218359
AA Change: Y76*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219761
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAACCTGAATCCGACTCCTGCTTG -3'
(R):5'- TAGTTCAGCCCGAAGCCAATCACG -3'

Sequencing Primer
(F):5'- GACCCTAAGTTAGCAGTTATGTCC -3'
(R):5'- TCCAAATTGGATTAGCAAGAGGTC -3'
Posted On2013-04-11