Incidental Mutation 'R1749:Slc14a2'
ID194241
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78147080 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 885 (T885P)
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000160639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025434
AA Change: T885P

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: T885P

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160639
SMART Domains Protein: ENSMUSP00000125367
Gene: ENSMUSG00000059336

DomainStartEndE-ValueType
Pfam:UT 52 356 1.6e-120 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTAGGTGCAGACCATGTACCC -3'
(R):5'- GTCCAGTAGCCCCATTTTGGAAGG -3'

Sequencing Primer
(F):5'- GACCATGTACCCGGACAGAG -3'
(R):5'- CAGGATAAACTAAAGACCTGCTTTC -3'
Posted On2014-05-23