Incidental Mutation 'R1765:Clasp1'
ID194244
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene NameCLIP associating protein 1
Synonyms1700030C23Rik, B130045P17Rik, CLASP1, mCLASP1, 5730583A19Rik, CLASP1alpha
MMRRC Submission 039797-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R1765 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location118389058-118612678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118505531 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 247 (S247P)
Ref Sequence ENSEMBL: ENSMUSP00000142203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000190571] [ENSMUST00000190733] [ENSMUST00000191445] [ENSMUST00000191823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049404
AA Change: S479P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070989
AA Change: S479P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165223
AA Change: S479P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178710
AA Change: S479P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185405
AA Change: S479P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186349
AA Change: S479P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187713
AA Change: S479P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188710
AA Change: S479P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189216
Predicted Effect probably damaging
Transcript: ENSMUST00000189262
AA Change: S479P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189570
AA Change: S479P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189676
Predicted Effect probably damaging
Transcript: ENSMUST00000189738
AA Change: S479P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190135
Predicted Effect probably damaging
Transcript: ENSMUST00000190571
AA Change: S479P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Predicted Effect probably damaging
Transcript: ENSMUST00000191445
AA Change: S479P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302
AA Change: S479P

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191823
AA Change: S247P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142203
Gene: ENSMUSG00000064302
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
TOG 87 319 5.6e-16 SMART
low complexity region 347 362 N/A INTRINSIC
low complexity region 374 401 N/A INTRINSIC
low complexity region 450 483 N/A INTRINSIC
low complexity region 537 551 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
TOG 594 832 1.6e-5 SMART
low complexity region 843 860 N/A INTRINSIC
low complexity region 933 944 N/A INTRINSIC
TOG 995 1233 2.4e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204886
Predicted Effect probably benign
Transcript: ENSMUST00000204904
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A C 4: 35,197,098 H322Q probably damaging Het
4933412E24Rik G T 15: 60,015,345 C415* probably null Het
A430105I19Rik G A 2: 118,760,647 A135V probably benign Het
Adamtsl2 A C 2: 27,102,830 I652L probably benign Het
Adgrl4 T C 3: 151,543,235 I720T probably damaging Het
Agrn A T 4: 156,176,827 C604* probably null Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
B3galt2 C A 1: 143,646,469 N114K probably benign Het
Bud23 A T 5: 135,056,043 M59K probably benign Het
C3 C T 17: 57,224,401 probably null Het
Cc2d2a A T 5: 43,714,531 D903V probably damaging Het
Ccdc105 A T 10: 78,748,668 M340K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdan1 A C 2: 120,720,749 L1097V probably damaging Het
Cdc26 T A 4: 62,394,918 N62I probably benign Het
Cdc27 G T 11: 104,534,781 Q70K probably damaging Het
Cenpq A T 17: 40,924,287 probably null Het
Cep295 T C 9: 15,327,904 S1858G probably damaging Het
Cyp2w1 C T 5: 139,353,868 T71I probably damaging Het
Dcaf1 T C 9: 106,864,594 F1336S probably damaging Het
Dennd6b G A 15: 89,190,303 Q104* probably null Het
Dglucy T A 12: 100,850,102 probably null Het
Dnajc9 A G 14: 20,388,090 V148A possibly damaging Het
Dnmbp T A 19: 43,902,140 D396V possibly damaging Het
Dock10 T A 1: 80,605,823 I221F probably damaging Het
Dscam T C 16: 96,685,379 N1032S probably benign Het
Dsg4 A C 18: 20,456,831 Y346S probably benign Het
Dync1i2 A G 2: 71,249,415 H417R probably benign Het
Dysf G A 6: 84,190,902 probably null Het
Elovl1 A G 4: 118,430,510 M1V probably null Het
Eva1c A G 16: 90,904,247 S257G probably benign Het
Eya2 A T 2: 165,724,803 D258V probably damaging Het
Fam193a A G 5: 34,436,497 T113A probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fstl5 G T 3: 76,593,476 R404L possibly damaging Het
Glud1 T C 14: 34,325,584 probably benign Het
Gm10770 A C 2: 150,179,338 H86Q probably damaging Het
Gm13757 A T 2: 88,446,023 F305Y probably damaging Het
Gm5724 T C 6: 141,754,358 probably benign Het
Gzme C T 14: 56,118,414 G147D probably damaging Het
Herc3 T C 6: 58,888,660 V746A probably damaging Het
Hmga1 A G 17: 27,559,618 E17G probably damaging Het
Kdelr2 A T 5: 143,420,812 K206* probably null Het
Kng2 A G 16: 22,988,243 probably null Het
Lrrc41 G A 4: 116,089,051 R321H possibly damaging Het
Mapkapk2 A T 1: 131,058,761 M1K probably null Het
Me2 A G 18: 73,791,858 F263L probably damaging Het
Mkks A G 2: 136,880,367 L290P probably damaging Het
Mmp12 T A 9: 7,354,772 I255N probably damaging Het
Mogs A G 6: 83,116,803 D251G probably benign Het
Morf4l1 T A 9: 90,102,348 Y65F possibly damaging Het
Neb T C 2: 52,204,664 D5169G probably damaging Het
Nin A G 12: 70,042,891 L1250P probably damaging Het
Nomo1 G T 7: 46,066,293 G721V possibly damaging Het
Notch2 T G 3: 98,121,926 C1002G probably damaging Het
Npat T C 9: 53,570,222 Y1077H probably benign Het
Olfr1284 G A 2: 111,379,146 V49I probably benign Het
Olfr193 A G 16: 59,109,755 L285P probably damaging Het
Olfr376 T A 11: 73,375,344 N198K probably damaging Het
Olfr894 T C 9: 38,219,252 I143T probably benign Het
Otop2 A T 11: 115,324,678 I142F probably benign Het
Pacsin3 A G 2: 91,263,115 E279G possibly damaging Het
Pafah2 A G 4: 134,413,447 T243A probably benign Het
Pcdhgc5 A G 18: 37,821,860 H729R probably benign Het
Plcd1 T C 9: 119,071,806 D756G probably damaging Het
Prune2 A G 19: 17,125,598 E2707G probably damaging Het
Rit2 C T 18: 31,316,898 G16S probably damaging Het
Sec24c A G 14: 20,688,854 probably benign Het
Skint5 G T 4: 113,577,661 T1037K unknown Het
Slc28a2 T A 2: 122,460,395 probably null Het
Slc41a2 G A 10: 83,301,266 A259V probably damaging Het
Slc6a17 T A 3: 107,473,579 I537F possibly damaging Het
Smchd1 A T 17: 71,400,201 probably benign Het
Smg1 T C 7: 118,139,715 I3489V probably benign Het
Sytl3 T C 17: 6,699,683 L142P probably damaging Het
Tfr2 C T 5: 137,583,445 T598I probably damaging Het
Tmc2 A G 2: 130,260,225 Q770R probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Trim68 A T 7: 102,680,390 M177K possibly damaging Het
Trmt11 T C 10: 30,559,188 D325G probably benign Het
Ube3a C T 7: 59,286,114 T582I probably damaging Het
Usp13 G A 3: 32,915,770 E682K probably benign Het
Usp9y A G Y: 1,384,454 V688A possibly damaging Het
Uts2r A G 11: 121,161,269 T320A possibly damaging Het
Vmn1r34 A T 6: 66,637,496 M86K probably damaging Het
Vsig10 A G 5: 117,318,815 probably benign Het
Zbtb41 T A 1: 139,440,394 C607S probably benign Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118570889 missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118565260 critical splice donor site probably null
IGL02602:Clasp1 APN 1 118471785 missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118539266 missense probably benign 0.33
IGL02728:Clasp1 APN 1 118602377 missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118551104 missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118552043 missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118462547 missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118467896 missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118501323 nonsense probably null
IGL03122:Clasp1 APN 1 118510277 missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118505525 missense probably benign 0.33
IGL03248:Clasp1 APN 1 118602476 missense probably benign 0.01
IGL03388:Clasp1 APN 1 118505503 missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118565229 missense probably benign 0.09
R0079:Clasp1 UTSW 1 118543304 missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118539331 missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118552026 missense probably benign 0.39
R1448:Clasp1 UTSW 1 118508916 missense probably benign 0.01
R1497:Clasp1 UTSW 1 118552058 missense probably benign 0.42
R1607:Clasp1 UTSW 1 118504959 missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118590464 missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118548025 missense probably damaging 1.00
R1855:Clasp1 UTSW 1 118508894 missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118570931 missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118600585 critical splice donor site probably null
R1942:Clasp1 UTSW 1 118501348 missense possibly damaging 0.94
R2025:Clasp1 UTSW 1 118504899 missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118560095 missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118565183 missense probably benign 0.05
R2288:Clasp1 UTSW 1 118578878 missense probably benign
R2895:Clasp1 UTSW 1 118459838 missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118467881 missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118503848 missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118578906 missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118561078 missense probably damaging 1.00
R4609:Clasp1 UTSW 1 118503035 intron probably benign
R4679:Clasp1 UTSW 1 118543271 missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118543197 nonsense probably null
R4809:Clasp1 UTSW 1 118461250 missense probably benign 0.00
R4906:Clasp1 UTSW 1 118508910 nonsense probably null
R5048:Clasp1 UTSW 1 118547610 intron probably benign
R5298:Clasp1 UTSW 1 118547920 missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118467913 missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118497721 missense probably damaging 1.00
R5821:Clasp1 UTSW 1 118590484 missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118506908 unclassified probably benign
R6092:Clasp1 UTSW 1 118510298 missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118419817 missense probably benign 0.18
R6478:Clasp1 UTSW 1 118512180 nonsense probably null
R7090:Clasp1 UTSW 1 118482086 missense not run
V7581:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118551125 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CATCCCTCAGAACCACTTTGCTGAC -3'
(R):5'- TCACAATAGTGCATACTGCCCGC -3'

Sequencing Primer
(F):5'- AGAACCACTTTGCTGACCTAGTC -3'
(R):5'- ttcttacatgctatgcaagcac -3'
Posted On2014-05-23