Incidental Mutation 'R0035:Rad50'
ID19427
Institutional Source Beutler Lab
Gene Symbol Rad50
Ensembl Gene ENSMUSG00000020380
Gene NameRAD50 double strand break repair protein
SynonymsRad50l, Mrell
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0035 (G1)
Quality Score185
Status Validated
Chromosome11
Chromosomal Location53649519-53707319 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 53655027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020649]
Predicted Effect probably benign
Transcript: ENSMUST00000020649
SMART Domains Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 1.8e-31 PFAM
coiled coil region 397 534 N/A INTRINSIC
Pfam:Rad50_zn_hook 659 712 9.9e-16 PFAM
low complexity region 825 836 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
coiled coil region 1019 1075 N/A INTRINSIC
Pfam:SbcCD_C 1174 1251 1.1e-9 PFAM
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Rad50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Rad50 APN 11 53686311 intron probably benign
IGL00709:Rad50 APN 11 53669642 missense possibly damaging 0.49
IGL01080:Rad50 APN 11 53706068 missense probably damaging 1.00
IGL01357:Rad50 APN 11 53707021 missense probably damaging 1.00
IGL01979:Rad50 APN 11 53686178 nonsense probably null
IGL02481:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02483:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02673:Rad50 APN 11 53688240 missense probably benign 0.19
IGL02754:Rad50 APN 11 53702056 missense probably damaging 1.00
IGL03372:Rad50 APN 11 53695294 missense probably benign 0.20
PIT4131001:Rad50 UTSW 11 53694899 critical splice donor site probably null
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0270:Rad50 UTSW 11 53668025 missense probably damaging 1.00
R0373:Rad50 UTSW 11 53650519 missense probably damaging 1.00
R0567:Rad50 UTSW 11 53654956 missense probably damaging 1.00
R1132:Rad50 UTSW 11 53694961 missense possibly damaging 0.58
R1249:Rad50 UTSW 11 53692137 missense probably damaging 0.99
R1368:Rad50 UTSW 11 53683245 nonsense probably null
R1501:Rad50 UTSW 11 53688151 missense possibly damaging 0.68
R1506:Rad50 UTSW 11 53679485 missense probably damaging 0.98
R1633:Rad50 UTSW 11 53692859 missense probably benign 0.00
R1663:Rad50 UTSW 11 53668223 missense probably benign 0.01
R1847:Rad50 UTSW 11 53702107 missense possibly damaging 0.68
R1933:Rad50 UTSW 11 53680061 missense probably benign 0.16
R2176:Rad50 UTSW 11 53698209 missense probably benign 0.00
R2519:Rad50 UTSW 11 53707185 start gained probably benign
R3027:Rad50 UTSW 11 53695381 missense probably benign 0.00
R3894:Rad50 UTSW 11 53678870 missense probably benign 0.01
R4181:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4302:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4836:Rad50 UTSW 11 53650653 missense probably damaging 1.00
R4934:Rad50 UTSW 11 53684275 missense probably benign 0.05
R5047:Rad50 UTSW 11 53674696 critical splice donor site probably null
R5201:Rad50 UTSW 11 53698820 critical splice donor site probably null
R5325:Rad50 UTSW 11 53692863 missense probably benign 0.16
R5368:Rad50 UTSW 11 53684246 missense probably benign 0.02
R5403:Rad50 UTSW 11 53695281 critical splice donor site probably null
R5421:Rad50 UTSW 11 53674946 missense probably benign 0.02
R6282:Rad50 UTSW 11 53669770 splice site probably null
R6468:Rad50 UTSW 11 53692144 missense possibly damaging 0.81
R6469:Rad50 UTSW 11 53684235 missense probably benign 0.08
R6528:Rad50 UTSW 11 53652282 missense probably damaging 1.00
R6704:Rad50 UTSW 11 53698918 missense probably damaging 1.00
R6886:Rad50 UTSW 11 53686184 missense probably benign 0.01
R7055:Rad50 UTSW 11 53688102 missense probably benign 0.02
R7268:Rad50 UTSW 11 53684275 missense probably benign 0.01
R7288:Rad50 UTSW 11 53654949 nonsense probably null
R7380:Rad50 UTSW 11 53695396 missense probably benign 0.00
R7467:Rad50 UTSW 11 53654908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCCATGTCTGTCTCACAAGG -3'
(R):5'- GCAGACCACATGATCTGAGTCTTCC -3'

Sequencing Primer
(F):5'- TAAGACTTCTGTGACATCAGGGC -3'
(R):5'- TCTTCCTGGCCAGAGAGTTT -3'
Posted On2013-04-11