Incidental Mutation 'R1765:Tfr2'
ID194279
Institutional Source Beutler Lab
Gene Symbol Tfr2
Ensembl Gene ENSMUSG00000029716
Gene Nametransferrin receptor 2
SynonymsTrfr2, Tfr2
MMRRC Submission 039797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1765 (G1)
Quality Score147
Status Validated
Chromosome5
Chromosomal Location137569840-137587481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137583445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 598 (T598I)
Ref Sequence ENSEMBL: ENSMUSP00000142478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031729] [ENSMUST00000196471] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably damaging
Transcript: ENSMUST00000031729
AA Change: T598I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716
AA Change: T598I

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196450
Predicted Effect probably damaging
Transcript: ENSMUST00000196471
AA Change: T598I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716
AA Change: T598I

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198783
AA Change: T598I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716
AA Change: T598I

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198866
AA Change: T598I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716
AA Change: T598I

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199054
AA Change: T598I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716
AA Change: T598I

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199069
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein, which is a member of the transferrin receptor-like family. This protein mediates cellular uptake of transferrin-bound iron, and may be involved in iron metabolism, hepatocyte function and erythrocyte differentiation. Mutations in this gene have been associated with hereditary hemochromatosis type III. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutant mice exhibit iron homeostasis defects similar to those observed in human hemachromatosis. On a standard diet, mutant mice show periportal hepatic iron loading, splenic iron sparing, and elevated serum transferrin saturations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A C 4: 35,197,098 H322Q probably damaging Het
4933412E24Rik G T 15: 60,015,345 C415* probably null Het
A430105I19Rik G A 2: 118,760,647 A135V probably benign Het
Adamtsl2 A C 2: 27,102,830 I652L probably benign Het
Adgrl4 T C 3: 151,543,235 I720T probably damaging Het
Agrn A T 4: 156,176,827 C604* probably null Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
B3galt2 C A 1: 143,646,469 N114K probably benign Het
Bud23 A T 5: 135,056,043 M59K probably benign Het
C3 C T 17: 57,224,401 probably null Het
Cc2d2a A T 5: 43,714,531 D903V probably damaging Het
Ccdc105 A T 10: 78,748,668 M340K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdan1 A C 2: 120,720,749 L1097V probably damaging Het
Cdc26 T A 4: 62,394,918 N62I probably benign Het
Cdc27 G T 11: 104,534,781 Q70K probably damaging Het
Cenpq A T 17: 40,924,287 probably null Het
Cep295 T C 9: 15,327,904 S1858G probably damaging Het
Clasp1 T C 1: 118,505,531 S247P probably damaging Het
Cyp2w1 C T 5: 139,353,868 T71I probably damaging Het
Dcaf1 T C 9: 106,864,594 F1336S probably damaging Het
Dennd6b G A 15: 89,190,303 Q104* probably null Het
Dglucy T A 12: 100,850,102 probably null Het
Dnajc9 A G 14: 20,388,090 V148A possibly damaging Het
Dnmbp T A 19: 43,902,140 D396V possibly damaging Het
Dock10 T A 1: 80,605,823 I221F probably damaging Het
Dscam T C 16: 96,685,379 N1032S probably benign Het
Dsg4 A C 18: 20,456,831 Y346S probably benign Het
Dync1i2 A G 2: 71,249,415 H417R probably benign Het
Dysf G A 6: 84,190,902 probably null Het
Elovl1 A G 4: 118,430,510 M1V probably null Het
Eva1c A G 16: 90,904,247 S257G probably benign Het
Eya2 A T 2: 165,724,803 D258V probably damaging Het
Fam193a A G 5: 34,436,497 T113A probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fstl5 G T 3: 76,593,476 R404L possibly damaging Het
Glud1 T C 14: 34,325,584 probably benign Het
Gm10770 A C 2: 150,179,338 H86Q probably damaging Het
Gm13757 A T 2: 88,446,023 F305Y probably damaging Het
Gm5724 T C 6: 141,754,358 probably benign Het
Gzme C T 14: 56,118,414 G147D probably damaging Het
Herc3 T C 6: 58,888,660 V746A probably damaging Het
Hmga1 A G 17: 27,559,618 E17G probably damaging Het
Kdelr2 A T 5: 143,420,812 K206* probably null Het
Kng2 A G 16: 22,988,243 probably null Het
Lrrc41 G A 4: 116,089,051 R321H possibly damaging Het
Mapkapk2 A T 1: 131,058,761 M1K probably null Het
Me2 A G 18: 73,791,858 F263L probably damaging Het
Mkks A G 2: 136,880,367 L290P probably damaging Het
Mmp12 T A 9: 7,354,772 I255N probably damaging Het
Mogs A G 6: 83,116,803 D251G probably benign Het
Morf4l1 T A 9: 90,102,348 Y65F possibly damaging Het
Neb T C 2: 52,204,664 D5169G probably damaging Het
Nin A G 12: 70,042,891 L1250P probably damaging Het
Nomo1 G T 7: 46,066,293 G721V possibly damaging Het
Notch2 T G 3: 98,121,926 C1002G probably damaging Het
Npat T C 9: 53,570,222 Y1077H probably benign Het
Olfr1284 G A 2: 111,379,146 V49I probably benign Het
Olfr193 A G 16: 59,109,755 L285P probably damaging Het
Olfr376 T A 11: 73,375,344 N198K probably damaging Het
Olfr894 T C 9: 38,219,252 I143T probably benign Het
Otop2 A T 11: 115,324,678 I142F probably benign Het
Pacsin3 A G 2: 91,263,115 E279G possibly damaging Het
Pafah2 A G 4: 134,413,447 T243A probably benign Het
Pcdhgc5 A G 18: 37,821,860 H729R probably benign Het
Plcd1 T C 9: 119,071,806 D756G probably damaging Het
Prune2 A G 19: 17,125,598 E2707G probably damaging Het
Rit2 C T 18: 31,316,898 G16S probably damaging Het
Sec24c A G 14: 20,688,854 probably benign Het
Skint5 G T 4: 113,577,661 T1037K unknown Het
Slc28a2 T A 2: 122,460,395 probably null Het
Slc41a2 G A 10: 83,301,266 A259V probably damaging Het
Slc6a17 T A 3: 107,473,579 I537F possibly damaging Het
Smchd1 A T 17: 71,400,201 probably benign Het
Smg1 T C 7: 118,139,715 I3489V probably benign Het
Sytl3 T C 17: 6,699,683 L142P probably damaging Het
Tmc2 A G 2: 130,260,225 Q770R probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Trim68 A T 7: 102,680,390 M177K possibly damaging Het
Trmt11 T C 10: 30,559,188 D325G probably benign Het
Ube3a C T 7: 59,286,114 T582I probably damaging Het
Usp13 G A 3: 32,915,770 E682K probably benign Het
Usp9y A G Y: 1,384,454 V688A possibly damaging Het
Uts2r A G 11: 121,161,269 T320A possibly damaging Het
Vmn1r34 A T 6: 66,637,496 M86K probably damaging Het
Vsig10 A G 5: 117,318,815 probably benign Het
Zbtb41 T A 1: 139,440,394 C607S probably benign Het
Other mutations in Tfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tfr2 APN 5 137574455 missense probably null
IGL00960:Tfr2 APN 5 137571692 missense probably benign 0.00
IGL01360:Tfr2 APN 5 137571691 missense probably benign
IGL02967:Tfr2 APN 5 137582819 nonsense probably null
IGL02996:Tfr2 APN 5 137583466 missense probably benign
IGL03278:Tfr2 APN 5 137571036 nonsense probably null
iron-man UTSW 5 137583153 splice site probably benign
R0114:Tfr2 UTSW 5 137577465 missense probably benign 0.00
R1384:Tfr2 UTSW 5 137586820 splice site probably benign
R1525:Tfr2 UTSW 5 137579030 missense probably benign 0.00
R1545:Tfr2 UTSW 5 137583299 missense probably benign 0.03
R1908:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R1943:Tfr2 UTSW 5 137578921 missense probably benign
R3439:Tfr2 UTSW 5 137574651 missense probably benign 0.03
R4332:Tfr2 UTSW 5 137571734 missense probably damaging 1.00
R4626:Tfr2 UTSW 5 137571692 missense probably benign 0.00
R4915:Tfr2 UTSW 5 137583411 missense probably damaging 0.96
R4999:Tfr2 UTSW 5 137586925 missense probably benign 0.00
R5150:Tfr2 UTSW 5 137574490 missense probably benign 0.22
R5200:Tfr2 UTSW 5 137570980 splice site probably benign
R5936:Tfr2 UTSW 5 137587006 missense probably benign 0.00
R6165:Tfr2 UTSW 5 137580257 missense probably damaging 0.97
R6513:Tfr2 UTSW 5 137574531 splice site probably null
R7076:Tfr2 UTSW 5 137583574 missense not run
R7115:Tfr2 UTSW 5 137571715 missense not run
X0067:Tfr2 UTSW 5 137577548 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTATGAACAAGTGGCACTCACCC -3'
(R):5'- AGGTCCCCAGAGAACTCATTGAGG -3'

Sequencing Primer
(F):5'- TGGACAGCAGTGCATATTCC -3'
(R):5'- CAGAGAACTCATTGAGGTTGCC -3'
Posted On2014-05-23