Incidental Mutation 'R1765:Hmga1'
ID194325
Institutional Source Beutler Lab
Gene Symbol Hmga1
Ensembl Gene ENSMUSG00000046711
Gene Namehigh mobility group AT-hook 1
SynonymsHMGI(Y), Hmga1b, Hmgiy, HMGY, Hmga1a, Hmgi, HMG-I(Y)
MMRRC Submission 039797-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1765 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27556497-27563674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27559618 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000155922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080190] [ENSMUST00000114888] [ENSMUST00000117254] [ENSMUST00000117600] [ENSMUST00000118570] [ENSMUST00000118599] [ENSMUST00000119486] [ENSMUST00000145183] [ENSMUST00000154473] [ENSMUST00000231243] [ENSMUST00000231358] [ENSMUST00000231753] [ENSMUST00000231780] [ENSMUST00000231796] [ENSMUST00000231825] [ENSMUST00000231866] [ENSMUST00000231874] [ENSMUST00000231948] [ENSMUST00000232013] [ENSMUST00000232203] [ENSMUST00000232253] [ENSMUST00000232265] [ENSMUST00000232276] [ENSMUST00000232552]
Predicted Effect probably benign
Transcript: ENSMUST00000080190
SMART Domains Protein: ENSMUSP00000079081
Gene: ENSMUSG00000062753

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114888
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110538
Gene: ENSMUSG00000046711
AA Change: E17G

DomainStartEndE-ValueType
AT_hook 23 35 1.34e0 SMART
AT_hook 44 56 1.86e0 SMART
AT_hook 70 82 1.03e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117254
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113011
Gene: ENSMUSG00000046711
AA Change: E17G

DomainStartEndE-ValueType
AT_hook 23 35 2.69e0 SMART
AT_hook 55 67 1.86e0 SMART
AT_hook 81 93 1.03e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117600
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113068
Gene: ENSMUSG00000046711
AA Change: E17G

DomainStartEndE-ValueType
AT_hook 23 35 2.69e0 SMART
AT_hook 55 67 1.86e0 SMART
AT_hook 81 93 1.03e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118570
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114101
Gene: ENSMUSG00000046711
AA Change: E17G

DomainStartEndE-ValueType
AT_hook 23 35 1.34e0 SMART
AT_hook 44 56 1.86e0 SMART
AT_hook 70 82 1.03e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118599
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113015
Gene: ENSMUSG00000046711
AA Change: E17G

DomainStartEndE-ValueType
AT_hook 23 35 2.69e0 SMART
AT_hook 55 67 1.86e0 SMART
AT_hook 81 93 1.03e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119486
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113916
Gene: ENSMUSG00000046711
AA Change: E17G

DomainStartEndE-ValueType
AT_hook 23 35 2.69e0 SMART
AT_hook 55 67 1.86e0 SMART
AT_hook 81 93 1.03e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138728
Predicted Effect probably benign
Transcript: ENSMUST00000145183
Predicted Effect probably benign
Transcript: ENSMUST00000154473
SMART Domains Protein: ENSMUSP00000116199
Gene: ENSMUSG00000062753

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 63 74 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231243
AA Change: E17G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231358
AA Change: E17G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231483
Predicted Effect probably benign
Transcript: ENSMUST00000231753
Predicted Effect possibly damaging
Transcript: ENSMUST00000231780
AA Change: E17G

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000231796
AA Change: E17G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231825
AA Change: E17G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231866
AA Change: E17G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231874
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000231948
Predicted Effect possibly damaging
Transcript: ENSMUST00000232013
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000232203
Predicted Effect possibly damaging
Transcript: ENSMUST00000232253
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232265
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000232276
Predicted Effect possibly damaging
Transcript: ENSMUST00000232552
AA Change: E17G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: This locus encodes a member of the nuclear, non-histone high mobility group protein family. This architectural transcription factor binds to A-T rich DNA sequences and participates in enhanceosome formation, chromatin remodeling and regulation of transcription. This protein functions in many cellular processes, including cell growth and differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Although haploinsufficiency at this locus is not compatible with germline transmission of one allele at this locus, mice homozygous for two other disruptions are fertile. Abnormalities are seen in glucose metabolism and in the cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A C 4: 35,197,098 H322Q probably damaging Het
4933412E24Rik G T 15: 60,015,345 C415* probably null Het
A430105I19Rik G A 2: 118,760,647 A135V probably benign Het
Adamtsl2 A C 2: 27,102,830 I652L probably benign Het
Adgrl4 T C 3: 151,543,235 I720T probably damaging Het
Agrn A T 4: 156,176,827 C604* probably null Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
B3galt2 C A 1: 143,646,469 N114K probably benign Het
Bud23 A T 5: 135,056,043 M59K probably benign Het
C3 C T 17: 57,224,401 probably null Het
Cc2d2a A T 5: 43,714,531 D903V probably damaging Het
Ccdc105 A T 10: 78,748,668 M340K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdan1 A C 2: 120,720,749 L1097V probably damaging Het
Cdc26 T A 4: 62,394,918 N62I probably benign Het
Cdc27 G T 11: 104,534,781 Q70K probably damaging Het
Cenpq A T 17: 40,924,287 probably null Het
Cep295 T C 9: 15,327,904 S1858G probably damaging Het
Clasp1 T C 1: 118,505,531 S247P probably damaging Het
Cyp2w1 C T 5: 139,353,868 T71I probably damaging Het
Dcaf1 T C 9: 106,864,594 F1336S probably damaging Het
Dennd6b G A 15: 89,190,303 Q104* probably null Het
Dglucy T A 12: 100,850,102 probably null Het
Dnajc9 A G 14: 20,388,090 V148A possibly damaging Het
Dnmbp T A 19: 43,902,140 D396V possibly damaging Het
Dock10 T A 1: 80,605,823 I221F probably damaging Het
Dscam T C 16: 96,685,379 N1032S probably benign Het
Dsg4 A C 18: 20,456,831 Y346S probably benign Het
Dync1i2 A G 2: 71,249,415 H417R probably benign Het
Dysf G A 6: 84,190,902 probably null Het
Elovl1 A G 4: 118,430,510 M1V probably null Het
Eva1c A G 16: 90,904,247 S257G probably benign Het
Eya2 A T 2: 165,724,803 D258V probably damaging Het
Fam193a A G 5: 34,436,497 T113A probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fstl5 G T 3: 76,593,476 R404L possibly damaging Het
Glud1 T C 14: 34,325,584 probably benign Het
Gm10770 A C 2: 150,179,338 H86Q probably damaging Het
Gm13757 A T 2: 88,446,023 F305Y probably damaging Het
Gm5724 T C 6: 141,754,358 probably benign Het
Gzme C T 14: 56,118,414 G147D probably damaging Het
Herc3 T C 6: 58,888,660 V746A probably damaging Het
Kdelr2 A T 5: 143,420,812 K206* probably null Het
Kng2 A G 16: 22,988,243 probably null Het
Lrrc41 G A 4: 116,089,051 R321H possibly damaging Het
Mapkapk2 A T 1: 131,058,761 M1K probably null Het
Me2 A G 18: 73,791,858 F263L probably damaging Het
Mkks A G 2: 136,880,367 L290P probably damaging Het
Mmp12 T A 9: 7,354,772 I255N probably damaging Het
Mogs A G 6: 83,116,803 D251G probably benign Het
Morf4l1 T A 9: 90,102,348 Y65F possibly damaging Het
Neb T C 2: 52,204,664 D5169G probably damaging Het
Nin A G 12: 70,042,891 L1250P probably damaging Het
Nomo1 G T 7: 46,066,293 G721V possibly damaging Het
Notch2 T G 3: 98,121,926 C1002G probably damaging Het
Npat T C 9: 53,570,222 Y1077H probably benign Het
Olfr1284 G A 2: 111,379,146 V49I probably benign Het
Olfr193 A G 16: 59,109,755 L285P probably damaging Het
Olfr376 T A 11: 73,375,344 N198K probably damaging Het
Olfr894 T C 9: 38,219,252 I143T probably benign Het
Otop2 A T 11: 115,324,678 I142F probably benign Het
Pacsin3 A G 2: 91,263,115 E279G possibly damaging Het
Pafah2 A G 4: 134,413,447 T243A probably benign Het
Pcdhgc5 A G 18: 37,821,860 H729R probably benign Het
Plcd1 T C 9: 119,071,806 D756G probably damaging Het
Prune2 A G 19: 17,125,598 E2707G probably damaging Het
Rit2 C T 18: 31,316,898 G16S probably damaging Het
Sec24c A G 14: 20,688,854 probably benign Het
Skint5 G T 4: 113,577,661 T1037K unknown Het
Slc28a2 T A 2: 122,460,395 probably null Het
Slc41a2 G A 10: 83,301,266 A259V probably damaging Het
Slc6a17 T A 3: 107,473,579 I537F possibly damaging Het
Smchd1 A T 17: 71,400,201 probably benign Het
Smg1 T C 7: 118,139,715 I3489V probably benign Het
Sytl3 T C 17: 6,699,683 L142P probably damaging Het
Tfr2 C T 5: 137,583,445 T598I probably damaging Het
Tmc2 A G 2: 130,260,225 Q770R probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Trim68 A T 7: 102,680,390 M177K possibly damaging Het
Trmt11 T C 10: 30,559,188 D325G probably benign Het
Ube3a C T 7: 59,286,114 T582I probably damaging Het
Usp13 G A 3: 32,915,770 E682K probably benign Het
Usp9y A G Y: 1,384,454 V688A possibly damaging Het
Uts2r A G 11: 121,161,269 T320A possibly damaging Het
Vmn1r34 A T 6: 66,637,496 M86K probably damaging Het
Vsig10 A G 5: 117,318,815 probably benign Het
Zbtb41 T A 1: 139,440,394 C607S probably benign Het
Other mutations in Hmga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7083:Hmga1 UTSW 17 27560971 missense not run
Predicted Primers PCR Primer
(F):5'- ACCCCTAACTAAGGGACAAGGTAGC -3'
(R):5'- CACCTCTGGGCAGTAAGCATACAC -3'

Sequencing Primer
(F):5'- GTAGCGAAAAGCCTCAACTTG -3'
(R):5'- AGCTTTAGACACCCACCTGA -3'
Posted On2014-05-23