Incidental Mutation 'R1765:C3'
ID194327
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
MMRRC Submission 039797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1765 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationintron (2430 bp from exon)
DNA Base Change (assembly) C to T at 57224401 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect probably benign
Transcript: ENSMUST00000024988
AA Change: V298M

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: V298M

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176457
Predicted Effect probably null
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A C 4: 35,197,098 H322Q probably damaging Het
4933412E24Rik G T 15: 60,015,345 C415* probably null Het
A430105I19Rik G A 2: 118,760,647 A135V probably benign Het
Adamtsl2 A C 2: 27,102,830 I652L probably benign Het
Adgrl4 T C 3: 151,543,235 I720T probably damaging Het
Agrn A T 4: 156,176,827 C604* probably null Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
B3galt2 C A 1: 143,646,469 N114K probably benign Het
Bud23 A T 5: 135,056,043 M59K probably benign Het
Cc2d2a A T 5: 43,714,531 D903V probably damaging Het
Ccdc105 A T 10: 78,748,668 M340K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdan1 A C 2: 120,720,749 L1097V probably damaging Het
Cdc26 T A 4: 62,394,918 N62I probably benign Het
Cdc27 G T 11: 104,534,781 Q70K probably damaging Het
Cenpq A T 17: 40,924,287 probably null Het
Cep295 T C 9: 15,327,904 S1858G probably damaging Het
Clasp1 T C 1: 118,505,531 S247P probably damaging Het
Cyp2w1 C T 5: 139,353,868 T71I probably damaging Het
Dcaf1 T C 9: 106,864,594 F1336S probably damaging Het
Dennd6b G A 15: 89,190,303 Q104* probably null Het
Dglucy T A 12: 100,850,102 probably null Het
Dnajc9 A G 14: 20,388,090 V148A possibly damaging Het
Dnmbp T A 19: 43,902,140 D396V possibly damaging Het
Dock10 T A 1: 80,605,823 I221F probably damaging Het
Dscam T C 16: 96,685,379 N1032S probably benign Het
Dsg4 A C 18: 20,456,831 Y346S probably benign Het
Dync1i2 A G 2: 71,249,415 H417R probably benign Het
Dysf G A 6: 84,190,902 probably null Het
Elovl1 A G 4: 118,430,510 M1V probably null Het
Eva1c A G 16: 90,904,247 S257G probably benign Het
Eya2 A T 2: 165,724,803 D258V probably damaging Het
Fam193a A G 5: 34,436,497 T113A probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fstl5 G T 3: 76,593,476 R404L possibly damaging Het
Glud1 T C 14: 34,325,584 probably benign Het
Gm10770 A C 2: 150,179,338 H86Q probably damaging Het
Gm13757 A T 2: 88,446,023 F305Y probably damaging Het
Gm5724 T C 6: 141,754,358 probably benign Het
Gzme C T 14: 56,118,414 G147D probably damaging Het
Herc3 T C 6: 58,888,660 V746A probably damaging Het
Hmga1 A G 17: 27,559,618 E17G probably damaging Het
Kdelr2 A T 5: 143,420,812 K206* probably null Het
Kng2 A G 16: 22,988,243 probably null Het
Lrrc41 G A 4: 116,089,051 R321H possibly damaging Het
Mapkapk2 A T 1: 131,058,761 M1K probably null Het
Me2 A G 18: 73,791,858 F263L probably damaging Het
Mkks A G 2: 136,880,367 L290P probably damaging Het
Mmp12 T A 9: 7,354,772 I255N probably damaging Het
Mogs A G 6: 83,116,803 D251G probably benign Het
Morf4l1 T A 9: 90,102,348 Y65F possibly damaging Het
Neb T C 2: 52,204,664 D5169G probably damaging Het
Nin A G 12: 70,042,891 L1250P probably damaging Het
Nomo1 G T 7: 46,066,293 G721V possibly damaging Het
Notch2 T G 3: 98,121,926 C1002G probably damaging Het
Npat T C 9: 53,570,222 Y1077H probably benign Het
Olfr1284 G A 2: 111,379,146 V49I probably benign Het
Olfr193 A G 16: 59,109,755 L285P probably damaging Het
Olfr376 T A 11: 73,375,344 N198K probably damaging Het
Olfr894 T C 9: 38,219,252 I143T probably benign Het
Otop2 A T 11: 115,324,678 I142F probably benign Het
Pacsin3 A G 2: 91,263,115 E279G possibly damaging Het
Pafah2 A G 4: 134,413,447 T243A probably benign Het
Pcdhgc5 A G 18: 37,821,860 H729R probably benign Het
Plcd1 T C 9: 119,071,806 D756G probably damaging Het
Prune2 A G 19: 17,125,598 E2707G probably damaging Het
Rit2 C T 18: 31,316,898 G16S probably damaging Het
Sec24c A G 14: 20,688,854 probably benign Het
Skint5 G T 4: 113,577,661 T1037K unknown Het
Slc28a2 T A 2: 122,460,395 probably null Het
Slc41a2 G A 10: 83,301,266 A259V probably damaging Het
Slc6a17 T A 3: 107,473,579 I537F possibly damaging Het
Smchd1 A T 17: 71,400,201 probably benign Het
Smg1 T C 7: 118,139,715 I3489V probably benign Het
Sytl3 T C 17: 6,699,683 L142P probably damaging Het
Tfr2 C T 5: 137,583,445 T598I probably damaging Het
Tmc2 A G 2: 130,260,225 Q770R probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Trim68 A T 7: 102,680,390 M177K possibly damaging Het
Trmt11 T C 10: 30,559,188 D325G probably benign Het
Ube3a C T 7: 59,286,114 T582I probably damaging Het
Usp13 G A 3: 32,915,770 E682K probably benign Het
Usp9y A G Y: 1,384,454 V688A possibly damaging Het
Uts2r A G 11: 121,161,269 T320A possibly damaging Het
Vmn1r34 A T 6: 66,637,496 M86K probably damaging Het
Vsig10 A G 5: 117,318,815 probably benign Het
Zbtb41 T A 1: 139,440,394 C607S probably benign Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 intron probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 intron probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense not run
R7117:C3 UTSW 17 57212655 missense not run
Predicted Primers PCR Primer
(F):5'- AGCCTTGCCACCCCTTAGTCAAAG -3'
(R):5'- AGAAGATTTCTCTGGCCCACTCCC -3'

Sequencing Primer
(F):5'- AGCAAGCCTCACCTGAGTG -3'
(R):5'- CACCCCTTGGAATGAGAGCTTAG -3'
Posted On2014-05-23