Incidental Mutation 'R1766:Chd6'
ID194340
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 160966639 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1552 (L1552F)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: L1552F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: L1552F

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137152
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGTCAGGTAAGCCGCCCTCAG -3'
(R):5'- CAGGTGTTTAGTCAGGGCACACAG -3'

Sequencing Primer
(F):5'- GAGACTCTGAAGTCCTACTCACTG -3'
(R):5'- CACACAGCATTGGTTTAAGTGG -3'
Posted On2014-05-23