Incidental Mutation 'R1767:Ephx1'
ID194438
Institutional Source Beutler Lab
Gene Symbol Ephx1
Ensembl Gene ENSMUSG00000038776
Gene Nameepoxide hydrolase 1, microsomal
SynonymsEph-1, mEH, Eph1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180976210-181020904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180994677 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 101 (G101S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036928] [ENSMUST00000111068] [ENSMUST00000147585]
Predicted Effect probably damaging
Transcript: ENSMUST00000036928
AA Change: G225S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047551
Gene: ENSMUSG00000038776
AA Change: G225S

DomainStartEndE-ValueType
Pfam:EHN 50 160 2.1e-36 PFAM
Pfam:Abhydrolase_1 142 404 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111068
AA Change: G225S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106697
Gene: ENSMUSG00000038776
AA Change: G225S

DomainStartEndE-ValueType
Pfam:EHN 49 161 4.2e-38 PFAM
Pfam:Abhydrolase_6 144 430 3.7e-10 PFAM
Pfam:Abhydrolase_1 178 254 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147585
SMART Domains Protein: ENSMUSP00000122671
Gene: ENSMUSG00000038776

DomainStartEndE-ValueType
Pfam:EHN 49 130 2.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154133
AA Change: G101S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114363
Gene: ENSMUSG00000038776
AA Change: G101S

DomainStartEndE-ValueType
Pfam:EHN 1 37 1.2e-8 PFAM
Pfam:Abhydrolase_1 19 247 2.3e-26 PFAM
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly resistant to DMBA-induced skin carcinogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Adgrf5 A T 17: 43,450,564 Y1050F possibly damaging Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Alk T A 17: 71,900,698 H1014L possibly damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Uvrag A G 7: 99,099,394 I117T probably damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wdsub1 A T 2: 59,858,714 I388N probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in Ephx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ephx1 APN 1 180999821 missense possibly damaging 0.82
IGL00864:Ephx1 APN 1 180990451 missense probably damaging 1.00
IGL00972:Ephx1 APN 1 180999800 missense probably benign 0.02
IGL01577:Ephx1 APN 1 181001980 start codon destroyed probably null 0.96
IGL02718:Ephx1 APN 1 180999786 missense probably damaging 1.00
IGL03330:Ephx1 APN 1 180999806 missense possibly damaging 0.53
R1190:Ephx1 UTSW 1 180993929 missense probably benign 0.24
R1751:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R2437:Ephx1 UTSW 1 180996096 missense probably damaging 1.00
R2484:Ephx1 UTSW 1 180989972 missense probably damaging 1.00
R3623:Ephx1 UTSW 1 180989933 missense probably benign 0.35
R3696:Ephx1 UTSW 1 180989951 missense probably benign 0.03
R4674:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4675:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4769:Ephx1 UTSW 1 180995978 missense possibly damaging 0.62
R4883:Ephx1 UTSW 1 181001923 missense possibly damaging 0.76
R6827:Ephx1 UTSW 1 180989888 missense probably damaging 1.00
R6974:Ephx1 UTSW 1 180999722 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGAGACTGCTGAAGAGGGCTTG -3'
(R):5'- AGACGCTGCTATTGTTTAGCCCAAC -3'

Sequencing Primer
(F):5'- GCTTGGGGTGAACAGTCC -3'
(R):5'- TTTAGCCCAACAGTGGAGTC -3'
Posted On2014-05-23