Incidental Mutation 'R0035:Mark2'
ID19444
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene NameMAP/microtubule affinity regulating kinase 2
SynonymsEmk, Par-1
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R0035 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7275396-7341860 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 7284652 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000166461] [ENSMUST00000167767] [ENSMUST00000168872] [ENSMUST00000169541] [ENSMUST00000171352] [ENSMUST00000171393]
Predicted Effect probably benign
Transcript: ENSMUST00000025921
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032557
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051711
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163345
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164129
Predicted Effect probably benign
Transcript: ENSMUST00000164205
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165286
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165881
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165965
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166461
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167767
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably benign
Transcript: ENSMUST00000168872
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169541
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect probably benign
Transcript: ENSMUST00000171352
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171393
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171721
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7341184 missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7281238 missense probably benign 0.06
IGL02368:Mark2 APN 19 7284490 missense probably damaging 1.00
IGL02836:Mark2 APN 19 7278040 critical splice donor site probably null
IGL03233:Mark2 APN 19 7284726 missense possibly damaging 0.89
R0015:Mark2 UTSW 19 7285777 nonsense probably null
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0335:Mark2 UTSW 19 7281828 missense probably benign 0.27
R0627:Mark2 UTSW 19 7281960 critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7285981 splice site probably benign
R0744:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R0836:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R1099:Mark2 UTSW 19 7277425 missense probably benign 0.41
R1861:Mark2 UTSW 19 7290763 missense possibly damaging 0.73
R1873:Mark2 UTSW 19 7284515 missense probably damaging 1.00
R2160:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2161:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2162:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2308:Mark2 UTSW 19 7281934 missense probably damaging 1.00
R2844:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2845:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2846:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2902:Mark2 UTSW 19 7283448 missense probably benign 0.00
R2935:Mark2 UTSW 19 7285889 missense probably benign 0.09
R3853:Mark2 UTSW 19 7277290 missense probably damaging 1.00
R4377:Mark2 UTSW 19 7290689 missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7285948 missense probably damaging 1.00
R4737:Mark2 UTSW 19 7281232 missense probably damaging 0.96
R5103:Mark2 UTSW 19 7284503 missense probably damaging 1.00
R5154:Mark2 UTSW 19 7283074 missense probably damaging 0.99
R5579:Mark2 UTSW 19 7282816 missense probably damaging 1.00
R6163:Mark2 UTSW 19 7290761 missense probably benign 0.00
R6186:Mark2 UTSW 19 7283202 missense probably benign 0.01
R6387:Mark2 UTSW 19 7285902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCCATCACTTCGTTGTACCTC -3'
(R):5'- TCCGTTCTACATGTCCACGGACTG -3'

Sequencing Primer
(F):5'- GTACCTCTGGCCTACCAGC -3'
(R):5'- TGTCCACGGACTGTGAAAATC -3'
Posted On2013-04-11