Incidental Mutation 'R1767:Wdsub1'
ID194441
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59858714 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 388 (I388N)
Ref Sequence ENSEMBL: ENSMUSP00000099812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751]
Predicted Effect probably damaging
Transcript: ENSMUST00000028368
AA Change: I388N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988
AA Change: I388N

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102751
AA Change: I388N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988
AA Change: I388N

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138519
Predicted Effect probably benign
Transcript: ENSMUST00000139689
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144823
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Adgrf5 A T 17: 43,450,564 Y1050F possibly damaging Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Alk T A 17: 71,900,698 H1014L possibly damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Uvrag A G 7: 99,099,394 I117T probably damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 unclassified probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4987:Wdsub1 UTSW 2 59870393 intron probably benign
R4989:Wdsub1 UTSW 2 59870414 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6582:Wdsub1 UTSW 2 59878308 missense probably damaging 1.00
R6638:Wdsub1 UTSW 2 59870441 intron probably benign
R6678:Wdsub1 UTSW 2 59862631 missense probably benign 0.45
R6842:Wdsub1 UTSW 2 59878188 missense probably benign 0.09
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGGAGTCCTGAACACGGC -3'
(R):5'- CCAGGAGGCATCCAGCTTCATTAC -3'

Sequencing Primer
(F):5'- CCAGTCACAGCAAGCTTATG -3'
(R):5'- TCACTAACTCCGTCAGTGAGG -3'
Posted On2014-05-23