Mutagenetix > Incidental Mutations

Incidental Mutation 'R1767:Pcdh10'

194447

Institutional Source

Beutler Lab

Gene Symbol

Pcdh10

Ensembl Gene

ENSMUSG00000049100

Gene Name

protocadherin 10

Synonyms

6430521D13Rik, OL-pc, 6430703F07Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.272) question?

Stock #

R1767 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45378398-45435623 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 45384177 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 923 (H923L)

Ref Sequence

ENSEMBL: ENSMUSP00000131600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166126
AA Change: H923L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: H923L

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
Pfam:Cadherin_C_2	713	838	5e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170695
AA Change: H923L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: H923L

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	751	772	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171554
AA Change: H923L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: H923L

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	751	772	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193252

SMART Domains

Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	751	772	N/A	INTRINSIC
low complexity region	887	896	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195655

Meta Mutation Damage Score

0.246

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	T	C	4: 124,849,961	N128S	possibly damaging	Het
1700011H14Rik	G	A	14: 49,235,884	T128I	probably benign	Het
Adam26b	T	A	8: 43,519,911	I685F	probably benign	Het
Adgrf5	A	T	17: 43,450,564	Y1050F	possibly damaging	Het
Alcam	A	T	16: 52,270,714	N480K	probably damaging	Het
Alk	T	A	17: 71,900,698	H1014L	possibly damaging	Het
Arhgef2	A	G	3: 88,643,953	Q778R	probably damaging	Het
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Ascc3	T	A	10: 50,718,376	I1189N	probably damaging	Het
AU040320	G	A	4: 126,840,724	G713D	probably damaging	Het
Bmpr1a	A	G	14: 34,447,770		probably null	Het
Bpifa6	A	G	2: 153,987,227	T225A	possibly damaging	Het
Cacna1g	T	C	11: 94,459,802	S406G	probably benign	Het
Ccdc40	T	A	11: 119,230,696		probably null	Het
Cckbr	A	T	7: 105,434,551	I229F	possibly damaging	Het
Cers3	A	G	7: 66,783,403	K156R	probably damaging	Het
Chd1	T	A	17: 15,770,303	W1706R	probably damaging	Het
Col11a2	T	A	17: 34,063,895		probably benign	Het
Coq10b	A	G	1: 55,061,354	R66G	probably damaging	Het
Cpn2	A	T	16: 30,259,667	Y405*	probably null	Het
Dis3	A	T	14: 99,084,142	Y590N	probably damaging	Het
Dpy19l1	T	C	9: 24,462,584	H270R	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Ephx1	C	T	1: 180,994,677	G101S	probably damaging	Het
Flg	A	T	3: 93,279,913	Y224F	possibly damaging	Het
Focad	G	T	4: 88,357,468	V1105L	unknown	Het
Fzd1	A	G	5: 4,756,812	Y257H	probably benign	Het
Gm11116	T	C	5: 88,111,452		probably benign	Het
Gm11938	G	A	11: 99,603,245	S8F	unknown	Het
Gm9008	A	T	6: 76,497,605	N9K	unknown	Het
Grin3a	A	T	4: 49,844,423	V220E	probably damaging	Het
Gstt2	T	C	10: 75,834,264	D8G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hook3	A	G	8: 26,071,056		probably null	Het
Itpr2	T	C	6: 146,350,068	D993G	possibly damaging	Het
Jhy	T	C	9: 40,961,148	R22G	probably benign	Het
Krt13	A	C	11: 100,121,100	H132Q	possibly damaging	Het
Krtap27-1	G	A	16: 88,671,311	S115L	probably damaging	Het
L1td1	T	C	4: 98,737,449	V627A	probably benign	Het
Lrrn4cl	A	G	19: 8,851,771	T38A	probably benign	Het
Ly96	A	G	1: 16,706,175	T112A	probably benign	Het
Meltf	G	T	16: 31,883,929	C158F	probably damaging	Het
Mycbp2	A	T	14: 103,248,405	H1040Q	probably damaging	Het
Npas4	G	A	19: 4,988,183	P199L	probably benign	Het
Olfr1087	A	G	2: 86,690,384	M197T	probably benign	Het
Olfr530	T	C	7: 140,373,476	I45V	possibly damaging	Het
Olfr569	T	A	7: 102,887,626	I176F	probably damaging	Het
Pias3	T	C	3: 96,701,403	S228P	probably damaging	Het
Pign	A	G	1: 105,653,192	V154A	probably benign	Het
Plod3	T	A	5: 136,990,176	V305E	possibly damaging	Het
Prkra	G	T	2: 76,647,240	H40Q	possibly damaging	Het
Prss22	T	A	17: 23,996,357	E148D	probably benign	Het
Psg17	A	G	7: 18,816,802	V376A	possibly damaging	Het
Retnlg	A	T	16: 48,873,628	D49V	possibly damaging	Het
Rtp1	A	G	16: 23,431,374	E163G	probably damaging	Het
Slc6a20a	T	A	9: 123,637,100	I522F	probably damaging	Het
Slco5a1	T	C	1: 12,989,615	D294G	probably damaging	Het
Slco6d1	A	G	1: 98,490,549	T487A	possibly damaging	Het
Smarcc2	A	T	10: 128,469,082	D262V	possibly damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Ssbp3	G	T	4: 107,047,415	D336Y	probably damaging	Het
Sun2	A	G	15: 79,725,557	S694P	probably benign	Het
Tdp1	G	A	12: 99,891,343		probably null	Het
Tfap2a	A	T	13: 40,725,137	I204N	probably damaging	Het
Tfip11	T	A	5: 112,334,432	W519R	probably damaging	Het
Tie1	T	C	4: 118,476,176	E831G	possibly damaging	Het
Tjp1	A	G	7: 65,312,553		probably null	Het
Tln2	C	T	9: 67,286,514	A1773T	probably benign	Het
Tmem39b	A	C	4: 129,693,183	I78M	possibly damaging	Het
Trank1	T	C	9: 111,391,479	V2428A	probably benign	Het
Trim35	A	G	14: 66,304,168	E247G	probably damaging	Het
Tsc22d1	T	C	14: 76,418,102	S674P	probably damaging	Het
Tsn	A	T	1: 118,300,888	D201E	probably damaging	Het
Usp42	A	T	5: 143,714,866	V1134E	possibly damaging	Het
Uvrag	A	G	7: 99,099,394	I117T	probably damaging	Het
Vmn1r192	A	G	13: 22,187,271	S260P	probably benign	Het
Vmn2r110	C	T	17: 20,580,578	A531T	possibly damaging	Het
Wdsub1	A	T	2: 59,858,714	I388N	probably damaging	Het
Wnt10b	A	T	15: 98,772,675	L228Q	probably damaging	Het
Zbtb34	A	C	2: 33,411,336	S398A	possibly damaging	Het

Other mutations in Pcdh10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Pcdh10	APN	3	45380302	missense	probably damaging	1.00
IGL01115:Pcdh10	APN	3	45392775	missense	probably damaging	1.00
IGL01535:Pcdh10	APN	3	45379643	missense	probably damaging	1.00
IGL01600:Pcdh10	APN	3	45379487	missense	probably damaging	0.98
IGL01625:Pcdh10	APN	3	45379397	missense	probably damaging	0.99
IGL01966:Pcdh10	APN	3	45380298	missense	probably benign	0.05
IGL02232:Pcdh10	APN	3	45380942	missense	probably benign	0.00
IGL02490:Pcdh10	APN	3	45380487	missense	probably damaging	1.00
IGL02890:Pcdh10	APN	3	45392617	missense	probably damaging	1.00
IGL02976:Pcdh10	APN	3	45380013	missense	possibly damaging	0.92
IGL02997:Pcdh10	APN	3	45379362	missense	probably damaging	1.00
IGL03006:Pcdh10	APN	3	45379502	missense	probably damaging	0.99
IGL03385:Pcdh10	APN	3	45381512	missense	possibly damaging	0.77
R0025:Pcdh10	UTSW	3	45380499	missense	possibly damaging	0.93
R0157:Pcdh10	UTSW	3	45379701	missense	probably damaging	1.00
R0372:Pcdh10	UTSW	3	45379497	missense	probably damaging	1.00
R0652:Pcdh10	UTSW	3	45379764	missense	probably damaging	1.00
R0760:Pcdh10	UTSW	3	45380570	missense	probably benign	0.19
R0976:Pcdh10	UTSW	3	45380801	missense	probably damaging	1.00
R1307:Pcdh10	UTSW	3	45381879	missense	probably benign	0.00
R1466:Pcdh10	UTSW	3	45379974	missense	probably damaging	1.00
R1466:Pcdh10	UTSW	3	45379974	missense	probably damaging	1.00
R1510:Pcdh10	UTSW	3	45379403	missense	probably damaging	1.00
R1619:Pcdh10	UTSW	3	45380312	missense	possibly damaging	0.94
R1678:Pcdh10	UTSW	3	45381881	nonsense	probably null
R1687:Pcdh10	UTSW	3	45380015	missense	probably damaging	1.00
R1750:Pcdh10	UTSW	3	45381881	nonsense	probably null
R1751:Pcdh10	UTSW	3	45384177	missense	probably damaging	1.00
R1857:Pcdh10	UTSW	3	45379937	missense	possibly damaging	0.86
R2086:Pcdh10	UTSW	3	45380471	missense	probably damaging	0.98
R3960:Pcdh10	UTSW	3	45379314	missense	probably benign
R4083:Pcdh10	UTSW	3	45392707	missense	probably damaging	1.00
R4084:Pcdh10	UTSW	3	45392707	missense	probably damaging	1.00
R4112:Pcdh10	UTSW	3	45381620	missense	probably damaging	1.00
R4754:Pcdh10	UTSW	3	45380637	missense	probably damaging	0.99
R4946:Pcdh10	UTSW	3	45379482	missense	probably damaging	1.00
R5039:Pcdh10	UTSW	3	45381861	missense	probably damaging	1.00
R5224:Pcdh10	UTSW	3	45392814	missense	probably damaging	0.99
R5233:Pcdh10	UTSW	3	45384191	missense	probably damaging	1.00
R5261:Pcdh10	UTSW	3	45381812	missense	probably damaging	1.00
R5429:Pcdh10	UTSW	3	45384200	missense	probably benign	0.00
R5488:Pcdh10	UTSW	3	45381368	missense	probably damaging	1.00
R5558:Pcdh10	UTSW	3	45384168	missense	probably damaging	1.00
R5784:Pcdh10	UTSW	3	45380640	missense	probably damaging	1.00
R5815:Pcdh10	UTSW	3	45392721	missense	probably benign	0.04
R6283:Pcdh10	UTSW	3	45381554	missense	possibly damaging	0.46
R6396:Pcdh10	UTSW	3	45380060	missense	possibly damaging	0.46
R6703:Pcdh10	UTSW	3	45381299	missense	possibly damaging	0.87
R6756:Pcdh10	UTSW	3	45380106	missense	possibly damaging	0.80
R6968:Pcdh10	UTSW	3	45379542	missense	probably damaging	1.00
X0013:Pcdh10	UTSW	3	45379566	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAATTGACTGTGAAGGCTCCG -3'
(R):5'- ATGTTATGAAGCCCACAGACACCTG -3'

Sequencing Primer
(F):5'- CATATGGAAATCCAAGAGTCTGC -3'
(R):5'- ACCTTTCTCTAGAATGCATGGTG -3'

Posted On

2014-05-23