Incidental Mutation 'R1767:Pias3'
ID194450
Institutional Source Beutler Lab
Gene Symbol Pias3
Ensembl Gene ENSMUSG00000028101
Gene Nameprotein inhibitor of activated STAT 3
SynonymsPias3L
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96696384-96706070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96701403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000102692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029742] [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000162778] [ENSMUST00000162934] [ENSMUST00000171249] [ENSMUST00000176302] [ENSMUST00000200387]
Predicted Effect probably benign
Transcript: ENSMUST00000029742
SMART Domains Protein: ENSMUSP00000029742
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 252 2.2e-9 PFAM
low complexity region 273 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064900
AA Change: S263P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101
AA Change: S263P

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
low complexity region 70 109 N/A INTRINSIC
Pfam:PINIT 126 278 1.1e-38 PFAM
Pfam:zf-MIZ 323 372 1.7e-22 PFAM
low complexity region 608 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107076
AA Change: S254P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101
AA Change: S254P

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.1e-45 PFAM
Pfam:zf-Nse 305 361 8e-7 PFAM
Pfam:zf-MIZ 314 363 2.2e-21 PFAM
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107077
AA Change: S228P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101
AA Change: S228P

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
Pfam:PINIT 87 243 5.3e-46 PFAM
Pfam:zf-Nse 279 335 2.4e-7 PFAM
Pfam:zf-MIZ 288 337 7.4e-22 PFAM
low complexity region 573 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161296
Predicted Effect probably benign
Transcript: ENSMUST00000162156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162707
Predicted Effect probably benign
Transcript: ENSMUST00000162778
SMART Domains Protein: ENSMUSP00000125377
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 84 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162934
AA Change: S254P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101
AA Change: S254P

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.3e-46 PFAM
Pfam:zf-Nse 305 361 7e-8 PFAM
Pfam:zf-MIZ 314 363 2.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171249
SMART Domains Protein: ENSMUSP00000129851
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 235 1.2e-18 PFAM
low complexity region 256 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176288
Predicted Effect probably benign
Transcript: ENSMUST00000176302
SMART Domains Protein: ENSMUSP00000134835
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 2.57e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196773
Predicted Effect probably benign
Transcript: ENSMUST00000200387
SMART Domains Protein: ENSMUSP00000142879
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:NUDIX 79 125 4.2e-6 PFAM
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Double KO mice display a retinal phenotype reduced M-cone response at P21 and reduced S-cone and rod responses from 7 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Adgrf5 A T 17: 43,450,564 Y1050F possibly damaging Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Alk T A 17: 71,900,698 H1014L possibly damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Uvrag A G 7: 99,099,394 I117T probably damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wdsub1 A T 2: 59,858,714 I388N probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in Pias3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Pias3 APN 3 96699422 splice site probably benign
IGL01370:Pias3 APN 3 96703575 missense probably damaging 0.96
IGL01806:Pias3 APN 3 96703757 missense probably benign 0.02
IGL02533:Pias3 APN 3 96699616 missense possibly damaging 0.71
IGL02998:Pias3 APN 3 96702179 missense probably damaging 0.98
IGL03304:Pias3 APN 3 96700031 missense possibly damaging 0.65
R0764:Pias3 UTSW 3 96701295 missense probably damaging 1.00
R1611:Pias3 UTSW 3 96699697 unclassified probably null
R1697:Pias3 UTSW 3 96702225 missense probably damaging 1.00
R1751:Pias3 UTSW 3 96701403 missense probably damaging 1.00
R2184:Pias3 UTSW 3 96702221 missense possibly damaging 0.92
R2257:Pias3 UTSW 3 96699646 missense probably benign 0.22
R2398:Pias3 UTSW 3 96703813 missense probably benign 0.00
R2851:Pias3 UTSW 3 96703537 missense possibly damaging 0.94
R3845:Pias3 UTSW 3 96702210 missense probably benign 0.28
R4127:Pias3 UTSW 3 96699666 missense probably damaging 0.97
R4500:Pias3 UTSW 3 96701418 missense probably damaging 1.00
R4628:Pias3 UTSW 3 96699820 missense probably damaging 1.00
R5068:Pias3 UTSW 3 96703855 missense probably damaging 0.98
R5108:Pias3 UTSW 3 96704937 missense possibly damaging 0.88
R5477:Pias3 UTSW 3 96705003 missense probably damaging 0.99
R5498:Pias3 UTSW 3 96702188 missense possibly damaging 0.89
R6457:Pias3 UTSW 3 96699523 missense possibly damaging 0.81
R6966:Pias3 UTSW 3 96702195 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTAGAGTTGAACCCCTCCCAGTG -3'
(R):5'- AATTGCCTCACCAGGTACACGGAC -3'

Sequencing Primer
(F):5'- TGCTCCCTCTCCACTAACAAATC -3'
(R):5'- AGAGGGACCATTAGCTTCTGC -3'
Posted On2014-05-23