Incidental Mutation 'R0077:Hecw2'
ID19446
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
SynonymsA730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission 038364-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R0077 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53806876-54195168 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 53868831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
Predicted Effect probably benign
Transcript: ENSMUST00000087659
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120904
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152870
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,771,685 probably benign Het
Adgrl4 A G 3: 151,517,781 I624V probably damaging Het
AI661453 A G 17: 47,469,362 probably benign Het
Alg12 C T 15: 88,815,978 E60K probably damaging Het
Angel2 A T 1: 190,933,087 N72Y possibly damaging Het
Ank1 C A 8: 23,140,167 P81Q probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Bpi T A 2: 158,261,334 M83K probably damaging Het
Capn7 A G 14: 31,368,115 I642V probably benign Het
Ccdc134 T C 15: 82,131,737 probably benign Het
Ccr3 C T 9: 124,029,024 T132I probably damaging Het
Cfap65 C A 1: 74,931,918 W80C probably damaging Het
Chaf1a T A 17: 56,047,384 I218K unknown Het
Ddx23 A G 15: 98,656,600 probably null Het
Dmkn A G 7: 30,765,294 S231G probably benign Het
Ep300 T C 15: 81,641,313 I1446T unknown Het
Fmnl1 T C 11: 103,189,969 F318S probably damaging Het
Grik5 A T 7: 25,023,380 V497E probably damaging Het
Gtf2ird2 T C 5: 134,214,083 Y380H probably damaging Het
Hspb7 A G 4: 141,424,047 I167V probably damaging Het
Kcnh2 T A 5: 24,322,702 N884I probably benign Het
Krba1 T C 6: 48,405,225 probably benign Het
Krt18 G T 15: 102,030,974 R294L probably benign Het
Lctl T A 9: 64,122,107 M1K probably null Het
Lingo2 G A 4: 35,708,375 S535F possibly damaging Het
Lrba A C 3: 86,542,688 N2105H probably damaging Het
Lrrc10 A G 10: 117,045,514 D31G probably damaging Het
Lrrtm1 T A 6: 77,243,872 V104E probably damaging Het
Mgat3 C T 15: 80,212,577 T535I probably benign Het
Nav3 T C 10: 109,716,642 I1780V possibly damaging Het
Nlrc4 A G 17: 74,446,831 W186R probably damaging Het
Nr2c1 T A 10: 94,188,255 F441I probably benign Het
Obscn A G 11: 59,051,521 probably benign Het
Olfr221 T C 14: 52,035,985 N42S possibly damaging Het
Olfr444 T C 6: 42,955,773 S92P probably benign Het
Olfr59 T C 11: 74,288,675 F10L probably benign Het
Olfr688 T C 7: 105,288,519 V142A probably damaging Het
Osr1 A T 12: 9,579,691 Y188F probably damaging Het
Pak2 A T 16: 32,033,843 N293K possibly damaging Het
Pappa A T 4: 65,307,812 T1301S probably damaging Het
Pde4dip G A 3: 97,753,126 Q679* probably null Het
Pik3r5 T A 11: 68,486,622 probably null Het
Plbd2 C T 5: 120,486,039 probably null Het
Ppp1r3a G T 6: 14,754,517 P244T possibly damaging Het
Pum1 C A 4: 130,772,674 R960S probably benign Het
Ralgapb T C 2: 158,473,249 Y845H probably damaging Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Rdh1 A T 10: 127,760,037 I34F probably damaging Het
Rgl3 T A 9: 21,974,102 Q644L probably benign Het
Rpap2 T C 5: 107,620,474 S393P probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
S100a11 A C 3: 93,524,202 probably null Het
Sept4 T C 11: 87,581,196 S11P probably benign Het
Serpina1c T C 12: 103,896,091 S322G probably benign Het
Setdb1 A T 3: 95,341,451 C385S probably damaging Het
Shank2 A T 7: 144,192,467 I193F possibly damaging Het
Slc4a11 G T 2: 130,686,301 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tbcd C A 11: 121,594,274 Q761K probably benign Het
Tmed6 C T 8: 107,065,566 V16M probably damaging Het
Tmem229a T C 6: 24,955,702 T18A probably benign Het
Tsc1 T A 2: 28,678,943 probably benign Het
Ube2m T C 7: 13,035,730 N49D probably damaging Het
Ubqlnl T C 7: 104,150,047 D81G probably damaging Het
Vmn2r56 A G 7: 12,715,405 V302A probably benign Het
Vmn2r73 T A 7: 85,875,867 R24S probably benign Het
Wfs1 C A 5: 36,973,194 S236I probably damaging Het
Xpot A T 10: 121,605,639 N560K probably benign Het
Yipf3 A G 17: 46,251,577 T303A probably benign Het
Zfp790 T C 7: 29,824,875 W19R probably damaging Het
Zfp846 T C 9: 20,594,007 C388R probably benign Het
Zpr1 T A 9: 46,273,336 I47N probably damaging Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 unclassified probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCGTCTCTCAGCAGTGTAGAAGC -3'
(R):5'- AAGCAAGGAGTGTGCCCTTTGG -3'

Sequencing Primer
(F):5'- GCATGAGTAAGCTAATTTTAGGGG -3'
(R):5'- TGTATTCCTAAAGTCCCATAGCACAG -3'
Posted On2013-04-11