Incidental Mutation 'R1767:Uvrag'
ID194472
Institutional Source Beutler Lab
Gene Symbol Uvrag
Ensembl Gene ENSMUSG00000035354
Gene NameUV radiation resistance associated gene
Synonyms9530039D02Rik, Uvragl
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98885021-99141141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99099394 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 117 (I117T)
Ref Sequence ENSEMBL: ENSMUSP00000146640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037968] [ENSMUST00000208992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037968
AA Change: I117T

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045297
Gene: ENSMUSG00000035354
AA Change: I117T

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
C2 42 147 1.43e-2 SMART
Pfam:Atg14 183 469 4.9e-21 PFAM
low complexity region 546 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208609
Predicted Effect probably damaging
Transcript: ENSMUST00000208992
AA Change: I117T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon induced knock-out allele are viable and fertile but exhibit impaired autophagic flux, autophagosome accumulation in the heart, and age-related cardiomyopathy associated with compromised cardiac function and heart inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Adgrf5 A T 17: 43,450,564 Y1050F possibly damaging Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Alk T A 17: 71,900,698 H1014L possibly damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wdsub1 A T 2: 59,858,714 I388N probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in Uvrag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Uvrag APN 7 98979741 missense probably damaging 0.99
IGL01085:Uvrag APN 7 99118224 missense probably damaging 1.00
IGL01362:Uvrag APN 7 98888513 missense probably benign 0.03
IGL01510:Uvrag APN 7 99004589 nonsense probably null
IGL02016:Uvrag APN 7 99099442 missense probably benign 0.06
IGL02164:Uvrag APN 7 99004689 nonsense probably null
IGL02170:Uvrag APN 7 99109090 nonsense probably null
IGL02836:Uvrag APN 7 98979777 missense possibly damaging 0.83
IGL02963:Uvrag APN 7 98906490 critical splice donor site probably null
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0304:Uvrag UTSW 7 98887973 missense probably benign 0.03
R0394:Uvrag UTSW 7 99004719 splice site probably benign
R0561:Uvrag UTSW 7 98888561 missense probably damaging 0.96
R1398:Uvrag UTSW 7 99065820 nonsense probably null
R1646:Uvrag UTSW 7 99118224 missense probably damaging 1.00
R1692:Uvrag UTSW 7 99004663 missense probably benign 0.02
R1760:Uvrag UTSW 7 98888348 missense probably benign 0.03
R2011:Uvrag UTSW 7 98939889 critical splice donor site probably null
R2484:Uvrag UTSW 7 98888461 missense probably benign 0.00
R3684:Uvrag UTSW 7 98988220 missense probably damaging 1.00
R3698:Uvrag UTSW 7 98939943 missense probably damaging 1.00
R3766:Uvrag UTSW 7 98888143 nonsense probably null
R3810:Uvrag UTSW 7 98979712 missense probably damaging 1.00
R4703:Uvrag UTSW 7 98989587 missense probably damaging 1.00
R5853:Uvrag UTSW 7 98888077 missense possibly damaging 0.80
R5896:Uvrag UTSW 7 98988207 nonsense probably null
R6185:Uvrag UTSW 7 99140832 critical splice donor site probably null
R6248:Uvrag UTSW 7 98988191 missense probably damaging 0.99
R6457:Uvrag UTSW 7 98906519 missense probably damaging 1.00
R6812:Uvrag UTSW 7 98888482 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATCCTCTGGGTTCCTTTCTGCTAC -3'
(R):5'- GAGCCACCTCATCAGCCTCTCT -3'

Sequencing Primer
(F):5'- caatcctcctgcctgttcc -3'
(R):5'- TCAGCCTCTCTTTTAGATTGAAAAC -3'
Posted On2014-05-23