Incidental Mutation 'R1767:Alk'
ID194523
Institutional Source Beutler Lab
Gene Symbol Alk
Ensembl Gene ENSMUSG00000055471
Gene Nameanaplastic lymphoma kinase
SynonymsCD246, Tcrz
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71869442-72603709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71900698 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1014 (H1014L)
Ref Sequence ENSEMBL: ENSMUSP00000083840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086639
AA Change: H1014L

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: H1014L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:MAM 270 431 5.6e-10 PFAM
LDLa 441 477 5.59e-3 SMART
Pfam:MAM 484 640 5.6e-22 PFAM
Pfam:Gly_rich 730 996 8.6e-19 PFAM
low complexity region 1037 1057 N/A INTRINSIC
TyrKc 1120 1387 2.76e-140 SMART
low complexity region 1440 1480 N/A INTRINSIC
low complexity region 1551 1570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Adgrf5 A T 17: 43,450,564 Y1050F possibly damaging Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Uvrag A G 7: 99,099,394 I117T probably damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wdsub1 A T 2: 59,858,714 I388N probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in Alk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Alk APN 17 71895748 missense probably damaging 1.00
IGL00796:Alk APN 17 71905142 missense possibly damaging 0.88
IGL01096:Alk APN 17 71921896 missense possibly damaging 0.87
IGL01367:Alk APN 17 71900786 missense probably damaging 1.00
IGL01402:Alk APN 17 71874178 missense probably damaging 1.00
IGL01652:Alk APN 17 72603531 missense probably damaging 1.00
IGL01717:Alk APN 17 72603382 missense probably benign
IGL02301:Alk APN 17 71874176 missense probably damaging 0.99
IGL02403:Alk APN 17 71901393 missense probably damaging 1.00
IGL02452:Alk APN 17 71902625 nonsense probably null
IGL02724:Alk APN 17 71985460 missense probably benign 0.00
IGL02826:Alk APN 17 71869536 missense probably damaging 1.00
IGL02863:Alk APN 17 71897835 missense probably damaging 1.00
IGL02994:Alk APN 17 71949820 missense probably benign 0.00
IGL03329:Alk APN 17 71899164 splice site probably benign
R0157:Alk UTSW 17 71949845 missense probably benign 0.00
R0211:Alk UTSW 17 72603516 missense probably damaging 1.00
R0257:Alk UTSW 17 72603495 missense probably damaging 1.00
R0269:Alk UTSW 17 72603583 missense probably damaging 1.00
R0395:Alk UTSW 17 72603531 missense probably damaging 0.99
R0414:Alk UTSW 17 71899286 splice site probably benign
R0466:Alk UTSW 17 71905157 missense possibly damaging 0.51
R0526:Alk UTSW 17 71869753 missense probably damaging 1.00
R0617:Alk UTSW 17 72603583 missense probably damaging 1.00
R0781:Alk UTSW 17 71984745 splice site probably benign
R0830:Alk UTSW 17 72603200 missense probably benign 0.01
R0835:Alk UTSW 17 71869842 missense probably damaging 0.97
R0894:Alk UTSW 17 71895935 missense probably damaging 1.00
R1110:Alk UTSW 17 71984745 splice site probably benign
R1170:Alk UTSW 17 71900734 missense probably damaging 1.00
R1573:Alk UTSW 17 72603118 missense possibly damaging 0.69
R1667:Alk UTSW 17 71911567 missense probably damaging 1.00
R1748:Alk UTSW 17 72603421 missense probably benign 0.19
R1836:Alk UTSW 17 71891037 missense probably damaging 1.00
R1861:Alk UTSW 17 71874938 splice site probably benign
R2905:Alk UTSW 17 71985494 missense probably benign 0.40
R2925:Alk UTSW 17 72603207 missense probably benign
R3727:Alk UTSW 17 71901400 splice site probably benign
R3747:Alk UTSW 17 71911565 missense probably damaging 0.99
R3790:Alk UTSW 17 72603432 missense possibly damaging 0.95
R3909:Alk UTSW 17 71897911 missense probably benign 0.00
R3934:Alk UTSW 17 72205954 missense probably damaging 1.00
R3936:Alk UTSW 17 72205954 missense probably damaging 1.00
R3972:Alk UTSW 17 71985447 missense probably benign 0.16
R4433:Alk UTSW 17 71899241 nonsense probably null
R4716:Alk UTSW 17 72205942 missense probably damaging 1.00
R4903:Alk UTSW 17 71869563 missense probably damaging 1.00
R4921:Alk UTSW 17 71904315 missense probably benign 0.30
R4954:Alk UTSW 17 71902692 nonsense probably null
R5377:Alk UTSW 17 71895739 missense probably damaging 1.00
R5386:Alk UTSW 17 71875012 missense probably damaging 1.00
R5551:Alk UTSW 17 71875033 missense possibly damaging 0.53
R5704:Alk UTSW 17 72603120 missense probably damaging 1.00
R5877:Alk UTSW 17 71967526 missense probably damaging 1.00
R5888:Alk UTSW 17 71874943 missense probably damaging 1.00
R6013:Alk UTSW 17 71900737 missense probably benign 0.15
R6044:Alk UTSW 17 71992100 missense probably benign 0.00
R6058:Alk UTSW 17 71869747 missense probably benign 0.01
R6126:Alk UTSW 17 71875042 missense possibly damaging 0.82
R6286:Alk UTSW 17 71880847 missense probably damaging 0.98
R6744:Alk UTSW 17 72603082 missense probably benign 0.35
R6989:Alk UTSW 17 71897952 missense probably benign 0.00
Z1088:Alk UTSW 17 72205807 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTTGCCCAGTTGCCAGAATATG -3'
(R):5'- TGCTTCCCCAAACAGATGTGCTC -3'

Sequencing Primer
(F):5'- CCAGTTGCCAGAATATGAACAAG -3'
(R):5'- AAACTGCAGTCACTGCGA -3'
Posted On2014-05-23