Incidental Mutation 'R1768:Ilf3'
ID194596
Institutional Source Beutler Lab
Gene Symbol Ilf3
Ensembl Gene ENSMUSG00000032178
Gene Nameinterleukin enhancer binding factor 3
SynonymsNF90
MMRRC Submission 039799-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1768 (G1)
Quality Score211
Status Validated
Chromosome9
Chromosomal Location21367871-21405361 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 21403142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067646] [ENSMUST00000115414] [ENSMUST00000213518] [ENSMUST00000213603] [ENSMUST00000214758] [ENSMUST00000216892] [ENSMUST00000217348]
Predicted Effect unknown
Transcript: ENSMUST00000067646
AA Change: F690S
SMART Domains Protein: ENSMUSP00000065770
Gene: ENSMUSG00000032178
AA Change: F690S

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
low complexity region 691 725 N/A INTRINSIC
low complexity region 745 769 N/A INTRINSIC
low complexity region 777 807 N/A INTRINSIC
low complexity region 810 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115414
SMART Domains Protein: ENSMUSP00000111074
Gene: ENSMUSG00000032178

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181812
Predicted Effect unknown
Transcript: ENSMUST00000213518
AA Change: F703S
Predicted Effect unknown
Transcript: ENSMUST00000213603
AA Change: F703S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214217
Predicted Effect unknown
Transcript: ENSMUST00000214758
AA Change: F703S
Predicted Effect probably benign
Transcript: ENSMUST00000215169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215438
Predicted Effect probably benign
Transcript: ENSMUST00000216892
Predicted Effect probably benign
Transcript: ENSMUST00000217348
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 91% (107/117)
MGI Phenotype FUNCTION: The protein encoded by this gene contains two double-stranded RNA binding domains and functions in the post-transcriptional regulation of gene expression. It is a component of an RNA-protein complex that may be involved in mediating the export of messenger RNAs. Alternative splicing results in multiple transcript variants encoding distinct isoforms. These isoforms are grouped into two categories, NFAR-1 or NFAR-2, based on variation at the C-terminus. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are born small and weak, show tachypnea and multi-organ apoptosis, and die neonatally due to neuromuscular respiratory failure. The diaphragm and other skeletal muscles show disorganization and paucity of myofibers,myocyte degeneration and elevated apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,623,470 R60P possibly damaging Het
Aox2 T A 1: 58,354,195 C1199S probably benign Het
Arhgap18 G A 10: 26,887,861 M482I probably damaging Het
Arhgap18 G T 10: 26,887,862 A483S probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
BC051019 T C 7: 109,723,174 T38A probably benign Het
Bcam T C 7: 19,765,618 N192S probably null Het
Bend5 A T 4: 111,454,241 K351* probably null Het
Bicdl2 T A 17: 23,665,949 M208K probably damaging Het
Ccdc155 T A 7: 45,188,803 probably null Het
Ccp110 A T 7: 118,726,024 probably null Het
Cdc6 A T 11: 98,912,217 T328S probably damaging Het
Cdk5rap2 G T 4: 70,307,233 N558K probably benign Het
Cdkn1c C T 7: 143,459,121 R146K probably benign Het
Ceacam18 G A 7: 43,648,494 C371Y probably benign Het
Cep95 T A 11: 106,806,351 C233* probably null Het
Chrnd A G 1: 87,194,928 I144V probably benign Het
Col6a4 T A 9: 106,080,100 Q175L probably benign Het
Cym A T 3: 107,213,500 V263E probably damaging Het
Cyp2a4 G T 7: 26,312,772 V327F possibly damaging Het
Dhx29 T A 13: 112,948,240 M664K probably damaging Het
Dlec1 T G 9: 119,146,007 probably null Het
Dna2 T C 10: 62,957,084 Y293H probably benign Het
Dnase1l3 T A 14: 7,974,104 N196Y probably damaging Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Efcab14 A T 4: 115,752,919 probably null Het
Entpd5 C T 12: 84,386,211 R189H probably benign Het
Exoc4 A T 6: 33,758,050 K534M probably damaging Het
Extl1 T A 4: 134,371,138 Y194F probably benign Het
Eya1 A G 1: 14,253,075 L161S possibly damaging Het
Fam163b T C 2: 27,112,862 E41G possibly damaging Het
Fam180a A C 6: 35,315,352 S40A probably benign Het
Fbxl4 T C 4: 22,385,950 S186P probably benign Het
Fbxw19 A T 9: 109,494,772 L45* probably null Het
Fgf14 G T 14: 124,676,512 T69N probably benign Het
Flt1 A G 5: 147,672,709 Y432H probably damaging Het
Frmd4b A T 6: 97,306,764 L374Q possibly damaging Het
G6pc2 T A 2: 69,222,977 V125D probably damaging Het
Gna15 A T 10: 81,512,120 L164Q probably damaging Het
Gnaz C A 10: 74,991,870 D151E possibly damaging Het
Has1 T C 17: 17,850,300 T120A probably benign Het
Hectd4 T A 5: 121,358,303 D3919E possibly damaging Het
Hs3st5 A G 10: 36,833,169 I233M probably benign Het
Inpp5b T A 4: 124,793,276 L765* probably null Het
Insr A T 8: 3,159,561 I1174N probably damaging Het
Kcnq3 A G 15: 66,005,906 L445P probably damaging Het
Kctd20 A T 17: 28,962,850 N159Y probably damaging Het
Kctd20 A T 17: 28,966,781 D366V probably damaging Het
Klk15 T C 7: 43,938,333 probably benign Het
Lama4 T G 10: 39,103,501 N1658K possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mas1 T C 17: 12,841,699 Y279C probably damaging Het
Mast2 G T 4: 116,306,959 D1747E probably damaging Het
Mest G A 6: 30,745,139 M235I probably benign Het
Mfsd6 A G 1: 52,660,805 probably null Het
Mllt10 T A 2: 18,162,846 S449R probably damaging Het
Mon2 T A 10: 123,013,763 T1211S probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Myh15 A T 16: 49,163,135 T1538S probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Npy1r A G 8: 66,704,525 D199G possibly damaging Het
Numbl A G 7: 27,280,954 T454A probably benign Het
Nutm2 T G 13: 50,473,116 F436V probably damaging Het
Olfr1112 T A 2: 87,191,698 S4T probably benign Het
Olfr330 A G 11: 58,529,776 L70P probably damaging Het
Olfr458 A G 6: 42,460,677 L114S probably damaging Het
Olfr556 A G 7: 102,670,301 Y127C probably damaging Het
Olfr631 C T 7: 103,929,725 R301* probably null Het
Olfr64 A G 7: 103,893,277 S153P probably benign Het
Olfr676 A G 7: 105,035,950 S251G probably benign Het
Olfr707 A T 7: 106,891,977 probably null Het
Olfr707 G T 7: 106,891,978 L44M probably damaging Het
Olfr876 T A 9: 37,804,303 Y131N probably damaging Het
Opa1 T C 16: 29,620,810 S773P probably benign Het
Pde8a G C 7: 81,300,723 probably null Het
Pgam1 T C 19: 41,917,705 F232S probably damaging Het
Pgk1 T A X: 106,200,308 V303E possibly damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Plxnc1 C T 10: 94,844,322 V824I probably benign Het
Ppp6r1 A G 7: 4,633,692 probably null Het
Rapgef4 C A 2: 72,225,787 probably benign Het
Rars T A 11: 35,809,638 T539S probably damaging Het
Rbm44 G T 1: 91,153,957 probably null Het
RP23-114B10.6 T C 8: 69,373,558 I119M unknown Het
Samd4b A G 7: 28,413,892 I216T probably benign Het
Serpine2 A C 1: 79,816,815 F134V probably damaging Het
Shmt1 A G 11: 60,792,964 Y341H probably damaging Het
Slc23a2 C A 2: 132,075,641 V226F probably benign Het
Slc23a4 A G 6: 34,956,961 I69T probably damaging Het
Slc37a1 C A 17: 31,333,678 T319K possibly damaging Het
Slc6a4 A T 11: 77,013,252 T178S probably damaging Het
Smarca4 G A 9: 21,701,183 A1588T possibly damaging Het
Spag17 A T 3: 100,027,352 Y650F possibly damaging Het
Stab2 C T 10: 87,003,008 G65S probably damaging Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Stip1 C A 19: 7,021,797 C471F probably damaging Het
Taf1 T C X: 101,540,894 S223P probably benign Het
Tchh C A 3: 93,443,575 N107K possibly damaging Het
Tenm3 A C 8: 48,232,104 H2432Q probably damaging Het
Tmem243 A G 5: 9,118,548 N110S probably damaging Het
Toe1 A T 4: 116,804,879 I306F probably benign Het
Trank1 G A 9: 111,392,927 V2911M probably damaging Het
Trpm4 A G 7: 45,308,612 I811T probably damaging Het
Tspear T A 10: 77,875,116 probably null Het
Ttc28 A T 5: 111,277,168 I1589F possibly damaging Het
Tubgcp3 A G 8: 12,649,686 probably benign Het
U2af2 C A 7: 5,067,545 R78S probably benign Het
Wdr17 A T 8: 54,673,654 D388E possibly damaging Het
Wdr3 A T 3: 100,153,870 S261T probably benign Het
Zfp667 A G 7: 6,305,067 N245D possibly damaging Het
Zfp692 A G 11: 58,310,176 probably benign Het
Zfp729a T C 13: 67,619,251 H953R probably benign Het
Other mutations in Ilf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ilf3 APN 9 21396051 missense probably damaging 1.00
IGL01013:Ilf3 APN 9 21399691 missense possibly damaging 0.91
IGL01352:Ilf3 APN 9 21392322 missense possibly damaging 0.89
IGL01975:Ilf3 APN 9 21392379 missense probably benign 0.03
IGL02826:Ilf3 APN 9 21398044 missense probably benign 0.20
IGL03238:Ilf3 APN 9 21392350 missense probably damaging 1.00
PIT4466001:Ilf3 UTSW 9 21403366 missense unknown
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0090:Ilf3 UTSW 9 21395414 missense probably damaging 1.00
R0355:Ilf3 UTSW 9 21397970 missense probably damaging 1.00
R1889:Ilf3 UTSW 9 21404767 unclassified probably benign
R1895:Ilf3 UTSW 9 21404767 unclassified probably benign
R1918:Ilf3 UTSW 9 21393714 missense probably damaging 1.00
R2930:Ilf3 UTSW 9 21399590 missense possibly damaging 0.91
R3912:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R3913:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R4080:Ilf3 UTSW 9 21403134 critical splice acceptor site probably null
R4412:Ilf3 UTSW 9 21399560 missense possibly damaging 0.77
R4510:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R4511:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R5201:Ilf3 UTSW 9 21389383 missense probably damaging 1.00
R5785:Ilf3 UTSW 9 21394872 missense probably damaging 1.00
R6303:Ilf3 UTSW 9 21403136 unclassified probably benign
R6406:Ilf3 UTSW 9 21396244 missense probably damaging 0.99
R6434:Ilf3 UTSW 9 21403151 unclassified probably benign
R7169:Ilf3 UTSW 9 21395426 missense probably damaging 0.96
X0066:Ilf3 UTSW 9 21392406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCTTGTGCTCCAATC -3'
(R):5'- TGGACACTGGAGGTCAACTCACTG -3'

Sequencing Primer
(F):5'- GAGCCTTGTGCTCCAATCTTTTTC -3'
(R):5'- GGAGGTCAACTCACTGAATTTGC -3'
Posted On2014-05-23