Incidental Mutation 'R1755:Adam23'
ID194744
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63543170 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 326 (V326M)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably damaging
Transcript: ENSMUST00000087374
AA Change: V326M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: V326M

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114103
AA Change: V326M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: V326M

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114107
AA Change: V326M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: V326M

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190658
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4066:Adam23 UTSW 1 63563425 missense probably damaging 1.00
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 intron probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTCCAGCTTGGCACAAAC -3'
(R):5'- TGAAGCCCAGACAGCACTTTCTTAC -3'

Sequencing Primer
(F):5'- GCTTGGCACAAACCAGTTTC -3'
(R):5'- GACAGCACTTTCTTACAAAGCTCTC -3'
Posted On2014-05-23