Incidental Mutation 'R1755:Epha4'
ID194745
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
MMRRC Submission 039787-MU
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77387823 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 683 (I683N)
Ref Sequence ENSEMBL: ENSMUSP00000139640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
PDB Structure
THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
[]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027451
AA Change: I683N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: I683N

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188797
AA Change: I683N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: I683N

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188952
AA Change: I683N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: I683N

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77426696 missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4321:Epha4 UTSW 1 77507213 critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5648:Epha4 UTSW 1 77398525 missense probably benign 0.25
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R5829:Epha4 UTSW 1 77444994 missense probably benign 0.01
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6486:Epha4 UTSW 1 77383549 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7039:Epha4 UTSW 1 77506785 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TTCACAGAAGTTGCCTTGGAGACAG -3'
(R):5'- CACAGGTGAATTTGGAGAGGTCTGC -3'

Sequencing Primer
(F):5'- AGACCCATTTAGAGCTGACTG -3'
(R):5'- AGCTGGCTATACTGACAAGC -3'
Posted On2014-05-23