Incidental Mutation 'R1755:Zfp106'
ID194757
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Namezinc finger protein 106
SynonymsCd-1, H3a, Sh3bp3, sirm
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120506820-120563843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120535175 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 250 (N250K)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
Predicted Effect probably damaging
Transcript: ENSMUST00000055241
AA Change: N273K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: N273K

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect probably benign
Transcript: ENSMUST00000163384
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171215
AA Change: N250K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: N250K

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120539497 missense probably benign 0.45
IGL00816:Zfp106 APN 2 120526848 missense probably benign 0.02
IGL00822:Zfp106 APN 2 120514160 missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120512727 missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120535035 missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120524464 missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120523553 missense probably benign 0.17
IGL01683:Zfp106 APN 2 120524555 missense probably benign 0.00
IGL01809:Zfp106 APN 2 120533671 missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120534807 missense probably benign 0.26
IGL01960:Zfp106 APN 2 120524043 missense probably damaging 0.99
IGL01960:Zfp106 APN 2 120539322 missense probably benign 0.08
IGL02168:Zfp106 APN 2 120534231 missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120545914 splice site probably null
IGL02798:Zfp106 APN 2 120510510 missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120531697 missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120528639 splice site probably benign
IGL03308:Zfp106 APN 2 120524024 missense probably benign 0.00
IGL03324:Zfp106 APN 2 120535387 missense probably benign 0.01
lepton UTSW 2 120532104 missense probably damaging 0.98
quark UTSW 2 120535060 nonsense probably null
string UTSW 2 120533594 missense probably damaging 0.96
theory UTSW 2 120533677 nonsense probably null
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120520487 missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120533875 missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120528472 splice site probably null
R0558:Zfp106 UTSW 2 120532196 missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120527016 missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120555248 missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120535603 missense probably benign 0.00
R1124:Zfp106 UTSW 2 120534714 missense probably benign 0.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120524079 missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120533594 missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120533677 nonsense probably null
R1754:Zfp106 UTSW 2 120533763 missense probably damaging 0.96
R1754:Zfp106 UTSW 2 120533764 missense probably damaging 0.98
R1763:Zfp106 UTSW 2 120520428 missense probably benign 0.03
R1875:Zfp106 UTSW 2 120513615 critical splice donor site probably null
R1903:Zfp106 UTSW 2 120526848 missense probably benign 0.02
R1932:Zfp106 UTSW 2 120531681 missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120523529 missense probably benign 0.11
R2301:Zfp106 UTSW 2 120535650 missense probably benign 0.04
R3429:Zfp106 UTSW 2 120527063 missense probably benign 0.00
R3720:Zfp106 UTSW 2 120534599 missense probably benign 0.01
R3875:Zfp106 UTSW 2 120534613 missense probably benign 0.08
R3881:Zfp106 UTSW 2 120532149 missense probably benign 0.01
R3921:Zfp106 UTSW 2 120533616 missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120534856 missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120526899 unclassified probably null
R4678:Zfp106 UTSW 2 120533740 missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120533919 missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120534727 missense probably benign 0.01
R5227:Zfp106 UTSW 2 120523968 missense probably benign 0.11
R5328:Zfp106 UTSW 2 120520417 missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120534781 missense probably benign 0.02
R5624:Zfp106 UTSW 2 120531957 missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120533507 unclassified probably null
R5691:Zfp106 UTSW 2 120524471 missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120516006 missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6298:Zfp106 UTSW 2 120522704 missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120532104 missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120534502 missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120535060 nonsense probably null
R6765:Zfp106 UTSW 2 120539454 missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120531632 missense probably damaging 0.99
X0025:Zfp106 UTSW 2 120534816 missense probably benign
Z1088:Zfp106 UTSW 2 120530490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAATGACTTCTTTCAGGGCTGAC -3'
(R):5'- GCTGGCATTCAAACAATGGGATGG -3'

Sequencing Primer
(F):5'- CTTTCAGGGCTGACTGTAAATC -3'
(R):5'- TTCAAACAATGGGATGGTAGATTGG -3'
Posted On2014-05-23