Incidental Mutation 'R1755:Orc3'
ID194761
Institutional Source Beutler Lab
Gene Symbol Orc3
Ensembl Gene ENSMUSG00000040044
Gene Nameorigin recognition complex, subunit 3
SynonymsOrc3l
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34570796-34614944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34575114 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 590 (A590V)
Ref Sequence ENSEMBL: ENSMUSP00000103777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048706] [ENSMUST00000108142]
Predicted Effect probably benign
Transcript: ENSMUST00000048706
AA Change: A591V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048319
Gene: ENSMUSG00000040044
AA Change: A591V

DomainStartEndE-ValueType
Pfam:ORC3_N 25 350 3e-130 PFAM
low complexity region 653 664 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108142
AA Change: A590V

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103777
Gene: ENSMUSG00000040044
AA Change: A590V

DomainStartEndE-ValueType
Pfam:ORC3_N 24 350 7.7e-136 PFAM
low complexity region 652 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156987
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the neural cells exhibit reduced neuronal precursor proliferation and reduced radial glial cell. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Orc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Orc3 APN 4 34595096 missense probably damaging 1.00
IGL03293:Orc3 APN 4 34595210 missense probably damaging 0.96
IGL02991:Orc3 UTSW 4 34593083 missense probably damaging 1.00
R0157:Orc3 UTSW 4 34607130 critical splice donor site probably null
R0708:Orc3 UTSW 4 34597368 missense probably damaging 1.00
R1331:Orc3 UTSW 4 34599748 missense probably benign 0.01
R1481:Orc3 UTSW 4 34607228 missense possibly damaging 0.50
R1886:Orc3 UTSW 4 34584829 missense probably damaging 1.00
R2008:Orc3 UTSW 4 34611049 unclassified probably null
R2054:Orc3 UTSW 4 34584846 missense probably damaging 0.97
R2307:Orc3 UTSW 4 34586503 missense probably damaging 1.00
R3001:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3002:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3153:Orc3 UTSW 4 34575124 missense probably damaging 0.99
R4044:Orc3 UTSW 4 34587055 nonsense probably null
R4814:Orc3 UTSW 4 34572450 splice site probably benign
R4825:Orc3 UTSW 4 34571774 missense possibly damaging 0.95
R4939:Orc3 UTSW 4 34593126 nonsense probably null
R6314:Orc3 UTSW 4 34579797 missense possibly damaging 0.85
R6867:Orc3 UTSW 4 34605539 missense probably damaging 1.00
R7227:Orc3 UTSW 4 34572542 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTGAGCAAATGCACATAGCCTC -3'
(R):5'- CCCTGAGAGCCTGCCTCAAAAG -3'

Sequencing Primer
(F):5'- GACTACTGACTGCTACTATCGCTAAG -3'
(R):5'- aatgcctcagagatgtgcc -3'
Posted On2014-05-23