Incidental Mutation 'R1755:Cox6b2'
Institutional Source Beutler Lab
Gene Symbol Cox6b2
Ensembl Gene ENSMUSG00000051811
Gene Namecytochrome c oxidase subunit VIb polypeptide 2
Synonyms1700067P11Rik, COXVIB2
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1755 (G1)
Quality Score218
Status Not validated
Chromosomal Location4751792-4753094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4751938 bp
Amino Acid Change Phenylalanine to Serine at position 74 (F74S)
Ref Sequence ENSEMBL: ENSMUSP00000138911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063324] [ENSMUST00000098853] [ENSMUST00000108582] [ENSMUST00000108583] [ENSMUST00000163574] [ENSMUST00000174409] [ENSMUST00000182048] [ENSMUST00000182111] [ENSMUST00000182173] [ENSMUST00000182738] [ENSMUST00000183334] [ENSMUST00000183971] [ENSMUST00000184143]
Predicted Effect probably damaging
Transcript: ENSMUST00000063324
AA Change: F84S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064988
Gene: ENSMUSG00000051811
AA Change: F84S

Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098853
SMART Domains Protein: ENSMUSP00000096452
Gene: ENSMUSG00000059851

Blast:SET 6 50 1e-10 BLAST
SET 110 224 1.17e-14 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108582
SMART Domains Protein: ENSMUSP00000104223
Gene: ENSMUSG00000059851

Blast:SET 6 50 1e-10 BLAST
SET 110 224 1.17e-14 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108583
SMART Domains Protein: ENSMUSP00000104224
Gene: ENSMUSG00000059851

Blast:SET 6 50 1e-10 BLAST
SET 110 224 1.17e-14 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174409
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518

low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182048
AA Change: F84S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138765
Gene: ENSMUSG00000051811
AA Change: F84S

Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182111
AA Change: F84S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138709
Gene: ENSMUSG00000051811
AA Change: F84S

Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182173
SMART Domains Protein: ENSMUSP00000138288
Gene: ENSMUSG00000051811

Pfam:COX6B 21 74 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182272
Predicted Effect unknown
Transcript: ENSMUST00000182738
AA Change: S70P
SMART Domains Protein: ENSMUSP00000138744
Gene: ENSMUSG00000051811
AA Change: S70P

Pfam:COX6B 21 74 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183334
Predicted Effect probably damaging
Transcript: ENSMUST00000183971
AA Change: F74S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138911
Gene: ENSMUSG00000051811
AA Change: F74S

Pfam:COX6B 21 75 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184143
SMART Domains Protein: ENSMUSP00000139239
Gene: ENSMUSG00000051811

Pfam:COX6B 21 60 2.1e-11 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Cox6b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Cox6b2 APN 7 4751930 nonsense probably null
R4231:Cox6b2 UTSW 7 4752835 start codon destroyed probably null 0.53
R4775:Cox6b2 UTSW 7 4752075 missense probably damaging 1.00
R4991:Cox6b2 UTSW 7 4752161 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcagtcagtaagcagtcacc -3'
Posted On2014-05-23