Incidental Mutation 'R1755:Utp20'
ID194788
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88809769 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 541 (S541P)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: S541P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: S541P

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCTCTAAGAGGTAGGGAAGGCAC -3'
(R):5'- CCCAGCAGTCAGTAAATGGTCGAG -3'

Sequencing Primer
(F):5'- GTGCTCTAACACCCCATGTTTTAAC -3'
(R):5'- GGAACAGTTCCCAGTCTTAAGC -3'
Posted On2014-05-23