Incidental Mutation 'R1755:Olfr412'
ID194790
Institutional Source Beutler Lab
Gene Symbol Olfr412
Ensembl Gene ENSMUSG00000058275
Gene Nameolfactory receptor 412
SynonymsMOR127-5P, GA_x6K02T2P1NL-4500587-4501525
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74362069-74366218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74364993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 108 (V108A)
Ref Sequence ENSEMBL: ENSMUSP00000149922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077794] [ENSMUST00000216362]
Predicted Effect probably damaging
Transcript: ENSMUST00000077794
AA Change: V108A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076967
Gene: ENSMUSG00000058275
AA Change: V108A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 172 1.8e-8 PFAM
Pfam:7tm_1 41 289 3.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216362
AA Change: V108A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Olfr412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Olfr412 APN 11 74364912 missense possibly damaging 0.82
IGL01395:Olfr412 APN 11 74364887 missense probably damaging 1.00
IGL01418:Olfr412 APN 11 74364984 missense possibly damaging 0.85
IGL01645:Olfr412 APN 11 74365533 missense possibly damaging 0.95
IGL02421:Olfr412 APN 11 74365191 missense probably damaging 1.00
IGL02424:Olfr412 APN 11 74365473 missense probably benign 0.09
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0206:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R0278:Olfr412 UTSW 11 74365202 missense probably damaging 1.00
R0698:Olfr412 UTSW 11 74365142 missense probably benign 0.00
R1424:Olfr412 UTSW 11 74364954 missense probably benign 0.05
R1549:Olfr412 UTSW 11 74365250 missense probably benign 0.00
R1659:Olfr412 UTSW 11 74364933 missense probably benign 0.01
R2031:Olfr412 UTSW 11 74364951 missense probably damaging 1.00
R2185:Olfr412 UTSW 11 74364746 missense probably benign
R3620:Olfr412 UTSW 11 74365224 missense probably damaging 1.00
R4568:Olfr412 UTSW 11 74365209 missense probably damaging 0.99
R4878:Olfr412 UTSW 11 74364848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAGCGCATCCTATTCTGGAC -3'
(R):5'- GTAGTGGATTTTCCGAGACCCACAG -3'

Sequencing Primer
(F):5'- GTCCATGTACCTGGTCACAGTG -3'
(R):5'- CCACAGAAGGTTACTCTGGTC -3'
Posted On2014-05-23