Incidental Mutation 'R1755:Cyp11b1'
ID194802
Institutional Source Beutler Lab
Gene Symbol Cyp11b1
Ensembl Gene ENSMUSG00000075604
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 1
SynonymsCyp11b-1, Cyp11b
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74834125-74841643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74838534 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 306 (Q306L)
Ref Sequence ENSEMBL: ENSMUSP00000127888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170259] [ENSMUST00000188180]
Predicted Effect probably benign
Transcript: ENSMUST00000170259
AA Change: Q306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127888
Gene: ENSMUSG00000075604
AA Change: Q306L

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 497 4.3e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane. The enzyme has steroid 18-hydroxylase activity to synthesize aldosterone and 18-oxocortisol as well as steroid 11 beta-hydroxylase activity. Mutations in this gene cause corticosterone methyl oxidase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit adrenal hypertrophy, abnormal organ weights, abnormal hormone levels, abnormal urine chemistry, hypokalemia, increased blood pressure, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Ufd1 T G 16: 18,823,253 C151W probably damaging Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Cyp11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Cyp11b1 APN 15 74835853 unclassified probably null
IGL01154:Cyp11b1 APN 15 74838534 missense probably benign
IGL01982:Cyp11b1 APN 15 74839403 missense possibly damaging 0.69
IGL02156:Cyp11b1 APN 15 74835797 missense probably benign 0.25
IGL02424:Cyp11b1 APN 15 74839236 missense probably benign 0.23
IGL02937:Cyp11b1 APN 15 74836559 missense possibly damaging 0.81
IGL03080:Cyp11b1 APN 15 74839436 splice site probably null
IGL03101:Cyp11b1 APN 15 74835854 missense probably benign 0.39
R1230:Cyp11b1 UTSW 15 74840942 missense probably benign 0.01
R1699:Cyp11b1 UTSW 15 74840817 missense possibly damaging 0.89
R2913:Cyp11b1 UTSW 15 74836421 missense probably damaging 0.99
R4361:Cyp11b1 UTSW 15 74839016 missense possibly damaging 0.87
R4459:Cyp11b1 UTSW 15 74836359 missense probably damaging 0.98
R5822:Cyp11b1 UTSW 15 74836821 missense probably null 1.00
R6921:Cyp11b1 UTSW 15 74840949 missense probably benign 0.00
R7214:Cyp11b1 UTSW 15 74836859 missense probably benign 0.00
X0064:Cyp11b1 UTSW 15 74841587 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TAGAGAAGACTCTGGGCCACTCAC -3'
(R):5'- TACCCCGGTATTACGATGCCACAC -3'

Sequencing Primer
(F):5'- TTGGCTCAGACATTTCACAAGC -3'
(R):5'- GGTATTACGATGCCACACTTTCTC -3'
Posted On2014-05-23