Incidental Mutation 'R1755:Ufd1'
ID194806
Institutional Source Beutler Lab
Gene Symbol Ufd1
Ensembl Gene ENSMUSG00000005262
Gene Nameubiquitin recognition factor in ER-associated degradation 1
SynonymsUfd1l, Ufd1
MMRRC Submission 039787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1755 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18811779-18835261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18823253 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 151 (C151W)
Ref Sequence ENSEMBL: ENSMUSP00000111241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005394] [ENSMUST00000115578] [ENSMUST00000163695] [ENSMUST00000171789] [ENSMUST00000172013]
Predicted Effect probably damaging
Transcript: ENSMUST00000005394
AA Change: C151W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005394
Gene: ENSMUSG00000005262
AA Change: C151W

DomainStartEndE-ValueType
Pfam:UFD1 18 194 2.1e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115578
AA Change: C151W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111241
Gene: ENSMUSG00000005262
AA Change: C151W

DomainStartEndE-ValueType
Pfam:UFD1 19 194 6.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163695
SMART Domains Protein: ENSMUSP00000132341
Gene: ENSMUSG00000005262

DomainStartEndE-ValueType
Pfam:UFD1 18 70 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170325
Predicted Effect probably benign
Transcript: ENSMUST00000171789
Predicted Effect probably benign
Transcript: ENSMUST00000172013
SMART Domains Protein: ENSMUSP00000128186
Gene: ENSMUSG00000005262

DomainStartEndE-ValueType
PDB:2YUJ|A 11 36 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172451
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable with no obvious heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik T G 6: 40,926,162 Y92S probably damaging Het
4933402J07Rik G A 8: 87,588,957 R225H possibly damaging Het
9330159F19Rik A T 10: 29,222,294 H199L possibly damaging Het
Acaca AC A 11: 84,276,564 probably null Het
Adam23 G A 1: 63,543,170 V326M probably damaging Het
Aldh1a2 T A 9: 71,261,741 Y168* probably null Het
Ano6 A G 15: 95,972,570 K869E possibly damaging Het
Aplp2 G A 9: 31,177,104 A106V probably damaging Het
Arhgdib T A 6: 136,929,614 K30* probably null Het
Arl11 A G 14: 61,310,944 T68A probably benign Het
Atg7 A G 6: 114,673,677 T83A possibly damaging Het
Card9 T C 2: 26,359,534 E5G probably damaging Het
Cars A G 7: 143,569,457 V474A probably damaging Het
Cd300ld2 A G 11: 115,013,775 F89L probably benign Het
Celf2 T A 2: 6,884,958 M1L probably benign Het
Cnot1 T C 8: 95,724,577 D2174G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cox6b2 A G 7: 4,751,938 F74S probably damaging Het
Cyp11b1 T A 15: 74,838,534 Q306L probably benign Het
Ddx3y A G Y: 1,279,543 I107T probably benign Het
Dnah5 A T 15: 28,326,636 Y1997F probably damaging Het
Epha4 A T 1: 77,387,823 I683N probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm13103 T C 4: 143,850,810 F3S probably damaging Het
Gmip A G 8: 69,814,124 I296M probably damaging Het
Gpr37l1 A G 1: 135,166,901 S202P probably damaging Het
Ifi208 C A 1: 173,677,910 D75E possibly damaging Het
Il24 T C 1: 130,883,943 N132S possibly damaging Het
Katnal2 A G 18: 77,012,067 C124R probably benign Het
Kcnq3 A T 15: 65,995,421 L791Q probably damaging Het
Kcns3 T A 12: 11,091,444 D418V probably benign Het
Kif13a A G 13: 46,752,613 V618A possibly damaging Het
Kif13a A T 13: 46,773,678 V1179E possibly damaging Het
Lpp A G 16: 24,845,124 I259V probably benign Het
Mapkapk2 A G 1: 131,058,350 probably null Het
March7 T C 2: 60,234,921 S514P probably benign Het
Mgea5 A T 19: 45,758,406 M735K possibly damaging Het
Nr4a2 T A 2: 57,109,092 L381F probably damaging Het
Nt5dc3 A G 10: 86,824,251 D328G probably damaging Het
Obox6 T C 7: 15,834,520 K144E probably damaging Het
Olfml2b G A 1: 170,681,777 V565M probably damaging Het
Olfr412 T C 11: 74,364,993 V108A probably damaging Het
Orc3 G A 4: 34,575,114 A590V possibly damaging Het
Picalm T C 7: 90,160,549 S78P possibly damaging Het
Por T A 5: 135,729,485 Y105* probably null Het
Ppara A G 15: 85,797,979 K292R probably benign Het
Ralgds T A 2: 28,550,546 I844N probably damaging Het
Rttn T C 18: 89,009,317 Y519H probably damaging Het
Scn9a A G 2: 66,501,716 V1261A probably benign Het
Slc2a2 T A 3: 28,713,662 probably null Het
Slc5a7 T C 17: 54,292,978 M136V probably benign Het
Smc4 C A 3: 69,034,108 A1232E probably damaging Het
Smg1 A T 7: 118,203,064 C270* probably null Het
Sparcl1 C T 5: 104,092,824 E245K probably benign Het
Taf2 T C 15: 55,016,454 H1162R probably damaging Het
Tlr3 T C 8: 45,397,973 D105G probably benign Het
Tmem62 T C 2: 120,984,477 probably null Het
Triobp G A 15: 78,966,479 A278T probably benign Het
Upk1b T G 16: 38,780,040 M193L probably benign Het
Usp15 A G 10: 123,133,044 M334T probably damaging Het
Utp20 A G 10: 88,809,769 S541P probably benign Het
Vmn1r61 A T 7: 5,611,303 L4* probably null Het
Vmn2r96 G A 17: 18,582,653 G83D possibly damaging Het
Wdr60 A G 12: 116,226,029 L620P probably damaging Het
Zbtb8a T C 4: 129,354,317 D387G possibly damaging Het
Zfp106 A T 2: 120,535,175 N250K probably damaging Het
Zfp292 A G 4: 34,811,043 V667A probably benign Het
Other mutations in Ufd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ufd1 APN 16 18827718 unclassified probably benign
IGL00944:Ufd1 APN 16 18825031 missense possibly damaging 0.89
IGL01104:Ufd1 APN 16 18814837 missense probably damaging 1.00
IGL01292:Ufd1 APN 16 18821114 missense probably damaging 0.99
IGL03381:Ufd1 APN 16 18825757 missense probably damaging 0.99
R0611:Ufd1 UTSW 16 18814876 missense possibly damaging 0.94
R0730:Ufd1 UTSW 16 18814887 missense probably damaging 0.99
R1527:Ufd1 UTSW 16 18814911 missense probably damaging 1.00
R4078:Ufd1 UTSW 16 18825778 missense possibly damaging 0.86
R4747:Ufd1 UTSW 16 18821082 missense probably damaging 0.98
R5532:Ufd1 UTSW 16 18817930 missense probably damaging 1.00
R6897:Ufd1 UTSW 16 18827100 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGAGTACCATAGCATTTGCCAGGG -3'
(R):5'- ATATGTACCACCAGGGTCAGCCAG -3'

Sequencing Primer
(F):5'- GGGCCTGCCAAAGAAATTC -3'
(R):5'- aggaagaaagaaagaaagaaagagag -3'
Posted On2014-05-23