Incidental Mutation 'R0077:Shank2'
ID19482
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 038364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0077 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144192467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 193 (I193F)
Ref Sequence ENSEMBL: ENSMUSP00000101520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000213146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105900
AA Change: I193F

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: I193F

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105902
AA Change: I572F

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: I572F

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213146
AA Change: I629F

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,771,685 probably benign Het
Adgrl4 A G 3: 151,517,781 I624V probably damaging Het
AI661453 A G 17: 47,469,362 probably benign Het
Alg12 C T 15: 88,815,978 E60K probably damaging Het
Angel2 A T 1: 190,933,087 N72Y possibly damaging Het
Ank1 C A 8: 23,140,167 P81Q probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Bpi T A 2: 158,261,334 M83K probably damaging Het
Capn7 A G 14: 31,368,115 I642V probably benign Het
Ccdc134 T C 15: 82,131,737 probably benign Het
Ccr3 C T 9: 124,029,024 T132I probably damaging Het
Cfap65 C A 1: 74,931,918 W80C probably damaging Het
Chaf1a T A 17: 56,047,384 I218K unknown Het
Ddx23 A G 15: 98,656,600 probably null Het
Dmkn A G 7: 30,765,294 S231G probably benign Het
Ep300 T C 15: 81,641,313 I1446T unknown Het
Fmnl1 T C 11: 103,189,969 F318S probably damaging Het
Grik5 A T 7: 25,023,380 V497E probably damaging Het
Gtf2ird2 T C 5: 134,214,083 Y380H probably damaging Het
Hecw2 C T 1: 53,868,831 probably benign Het
Hspb7 A G 4: 141,424,047 I167V probably damaging Het
Kcnh2 T A 5: 24,322,702 N884I probably benign Het
Krba1 T C 6: 48,405,225 probably benign Het
Krt18 G T 15: 102,030,974 R294L probably benign Het
Lctl T A 9: 64,122,107 M1K probably null Het
Lingo2 G A 4: 35,708,375 S535F possibly damaging Het
Lrba A C 3: 86,542,688 N2105H probably damaging Het
Lrrc10 A G 10: 117,045,514 D31G probably damaging Het
Lrrtm1 T A 6: 77,243,872 V104E probably damaging Het
Mgat3 C T 15: 80,212,577 T535I probably benign Het
Nav3 T C 10: 109,716,642 I1780V possibly damaging Het
Nlrc4 A G 17: 74,446,831 W186R probably damaging Het
Nr2c1 T A 10: 94,188,255 F441I probably benign Het
Obscn A G 11: 59,051,521 probably benign Het
Olfr221 T C 14: 52,035,985 N42S possibly damaging Het
Olfr444 T C 6: 42,955,773 S92P probably benign Het
Olfr59 T C 11: 74,288,675 F10L probably benign Het
Olfr688 T C 7: 105,288,519 V142A probably damaging Het
Osr1 A T 12: 9,579,691 Y188F probably damaging Het
Pak2 A T 16: 32,033,843 N293K possibly damaging Het
Pappa A T 4: 65,307,812 T1301S probably damaging Het
Pde4dip G A 3: 97,753,126 Q679* probably null Het
Pik3r5 T A 11: 68,486,622 probably null Het
Plbd2 C T 5: 120,486,039 probably null Het
Ppp1r3a G T 6: 14,754,517 P244T possibly damaging Het
Pum1 C A 4: 130,772,674 R960S probably benign Het
Ralgapb T C 2: 158,473,249 Y845H probably damaging Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Rdh1 A T 10: 127,760,037 I34F probably damaging Het
Rgl3 T A 9: 21,974,102 Q644L probably benign Het
Rpap2 T C 5: 107,620,474 S393P probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
S100a11 A C 3: 93,524,202 probably null Het
Sept4 T C 11: 87,581,196 S11P probably benign Het
Serpina1c T C 12: 103,896,091 S322G probably benign Het
Setdb1 A T 3: 95,341,451 C385S probably damaging Het
Slc4a11 G T 2: 130,686,301 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tbcd C A 11: 121,594,274 Q761K probably benign Het
Tmed6 C T 8: 107,065,566 V16M probably damaging Het
Tmem229a T C 6: 24,955,702 T18A probably benign Het
Tsc1 T A 2: 28,678,943 probably benign Het
Ube2m T C 7: 13,035,730 N49D probably damaging Het
Ubqlnl T C 7: 104,150,047 D81G probably damaging Het
Vmn2r56 A G 7: 12,715,405 V302A probably benign Het
Vmn2r73 T A 7: 85,875,867 R24S probably benign Het
Wfs1 C A 5: 36,973,194 S236I probably damaging Het
Xpot A T 10: 121,605,639 N560K probably benign Het
Yipf3 A G 17: 46,251,577 T303A probably benign Het
Zfp790 T C 7: 29,824,875 W19R probably damaging Het
Zfp846 T C 9: 20,594,007 C388R probably benign Het
Zpr1 T A 9: 46,273,336 I47N probably damaging Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCATCTGCCAAGCTGCTGACAG -3'
(R):5'- TGCCCTTTCACAGAACCTGCAC -3'

Sequencing Primer
(F):5'- CTTCTACCTGTGGTCTGGTG -3'
(R):5'- ACCCCAGCTTGTCAAGTG -3'
Posted On2013-04-11