Incidental Mutation 'R1756:Rhbdf2'
ID194883
Institutional Source Beutler Lab
Gene Symbol Rhbdf2
Ensembl Gene ENSMUSG00000020806
Gene Namerhomboid 5 homolog 2
SynonymsiRhom2, Rhbdl6, 4732465I17Rik
MMRRC Submission 039788-MU
Accession Numbers

VEGA: OTTMUST00000008766; MGI: 2442473

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1756 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116598165-116627019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116607266 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 36 (S36G)
Ref Sequence ENSEMBL: ENSMUSP00000099318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103028] [ENSMUST00000103029]
Predicted Effect probably benign
Transcript: ENSMUST00000103028
AA Change: S36G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806
AA Change: S36G

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103029
AA Change: S36G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806
AA Change: S36G

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138125
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display impaired TNF secretion and increased sensitivity to bacterial infection induced mortality. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted(4) Gene trapped(30)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,068,061 H382Q possibly damaging Het
A330008L17Rik C A 8: 99,421,882 noncoding transcript Het
Acin1 A G 14: 54,665,204 V377A probably benign Het
Adam39 A T 8: 40,825,324 I251F probably damaging Het
Adnp2 A T 18: 80,127,697 *1166K probably null Het
Akap12 T A 10: 4,357,574 D1461E probably benign Het
Apba1 A G 19: 23,893,692 D296G possibly damaging Het
Apol7a G T 15: 77,393,471 L26M possibly damaging Het
Bcl2 C T 1: 106,712,392 M163I probably damaging Het
Cap2 T G 13: 46,531,013 I53R probably benign Het
Ccdc105 T A 10: 78,747,197 K451M probably damaging Het
Ccdc74a T C 16: 17,650,468 V318A possibly damaging Het
Ccnb2 A G 9: 70,410,788 V234A probably benign Het
Cd207 C T 6: 83,675,597 V184I probably benign Het
Cdk12 C A 11: 98,241,761 C1005* probably null Het
Cep83 T C 10: 94,750,267 S344P probably damaging Het
Ces1g A T 8: 93,306,954 Y447N probably benign Het
Cfap54 A T 10: 93,048,061 L277Q probably damaging Het
Cfh A G 1: 140,100,877 Y1027H probably damaging Het
Clcnkb T A 4: 141,415,214 I28F possibly damaging Het
Clec4d A G 6: 123,267,109 D59G probably damaging Het
Colq G A 14: 31,547,452 P153S probably damaging Het
Crybg1 T A 10: 43,986,279 T1500S probably damaging Het
Cyp2d34 T A 15: 82,617,524 R262W probably damaging Het
Dennd4b C G 3: 90,271,605 L559V probably damaging Het
Dhrs1 A G 14: 55,739,309 V306A probably benign Het
Diaph1 A T 18: 37,854,573 D1043E possibly damaging Het
Dis3 G T 14: 99,086,103 D538E probably damaging Het
Dnaic2 T G 11: 114,750,380 S344A probably benign Het
Dner C T 1: 84,445,590 V431M probably damaging Het
Dnm1l A G 16: 16,342,695 probably null Het
Eps15 T G 4: 109,312,918 L139* probably null Het
Fam193a T A 5: 34,466,292 I55N possibly damaging Het
Gm10308 T A 17: 91,088,957 Y102* probably null Het
Gm10509 A G 17: 21,690,855 K30E possibly damaging Het
Gm4778 A T 3: 94,266,218 M174L probably benign Het
Gm9573 A T 17: 35,619,239 probably benign Het
Gpr155 T C 2: 73,367,577 M400V probably benign Het
H2-M10.2 T C 17: 36,286,123 probably benign Het
Heatr1 G T 13: 12,396,460 A61S probably benign Het
Helb G T 10: 120,094,242 T744K probably damaging Het
Hmcn1 C A 1: 150,599,030 W4702L probably damaging Het
Hmcn2 C T 2: 31,396,120 R2095W probably damaging Het
Igfbp3 G C 11: 7,208,461 D267E probably damaging Het
Ighmbp2 T A 19: 3,268,669 H469L probably damaging Het
Kcnj3 A C 2: 55,437,220 K7T probably damaging Het
Krtap5-5 T G 7: 142,229,621 K97N unknown Het
Lcor T C 19: 41,559,266 S430P probably benign Het
Lpin1 A G 12: 16,538,540 V883A probably damaging Het
Lrp1b T C 2: 41,110,825 Y2243C probably damaging Het
Lrrc46 G A 11: 97,034,730 probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Ncbp1 T A 4: 46,169,131 L635* probably null Het
Nipbl T C 15: 8,338,551 N1202D possibly damaging Het
Nphs1 A G 7: 30,461,534 D196G probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1008 A G 2: 85,690,083 Y218C probably damaging Het
Olfr1360 A G 13: 21,674,695 I83T probably benign Het
Olfr901 A T 9: 38,430,995 I238F probably benign Het
Pax8 A T 2: 24,435,821 N350K probably damaging Het
Pik3cd T C 4: 149,658,750 K298E probably benign Het
Pkd1 C T 17: 24,594,485 R4000C probably damaging Het
Pkn2 A T 3: 142,810,727 V546D possibly damaging Het
Plcg2 A G 8: 117,592,708 K673E probably benign Het
Pld4 T G 12: 112,763,392 probably null Het
Plek A T 11: 16,992,901 N130K probably damaging Het
Prune2 G A 19: 17,123,704 D2191N probably benign Het
Ptgis T C 2: 167,206,803 Y431C probably damaging Het
Rtn4ip1 C T 10: 43,910,830 A178V probably damaging Het
Rxfp1 A G 3: 79,670,881 S168P probably benign Het
Sec24a A G 11: 51,733,763 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk6 C T 14: 110,750,552 M574I probably benign Het
Slk T C 19: 47,622,677 F861L probably damaging Het
Smpd3 C A 8: 106,264,971 A317S probably benign Het
Spz1 T A 13: 92,575,125 Q281L probably damaging Het
Syde1 T A 10: 78,586,980 R519S probably benign Het
Taf4 T C 2: 179,976,531 H39R unknown Het
Tbx5 A T 5: 119,845,113 probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Th G A 7: 142,898,166 Q19* probably null Het
Tmprss11a T A 5: 86,420,179 I230F probably damaging Het
Tnfrsf14 T A 4: 154,925,322 H50L possibly damaging Het
Tpp2 T A 1: 43,978,725 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim2 A G 3: 84,190,800 I398T possibly damaging Het
Trpc5 A T X: 144,481,226 S212T probably damaging Het
Ttn A G 2: 76,787,334 probably benign Het
Unc80 A G 1: 66,639,248 T2063A possibly damaging Het
Usp37 A T 1: 74,479,655 S260T probably benign Het
Vcan A G 13: 89,691,681 S1915P probably benign Het
Vmn1r33 T A 6: 66,612,298 I91F possibly damaging Het
Zfp422 T C 6: 116,626,424 T205A probably benign Het
Other mutations in Rhbdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rhbdf2 APN 11 116601751 missense possibly damaging 0.80
IGL01464:Rhbdf2 APN 11 116600908 missense probably benign 0.18
IGL02060:Rhbdf2 APN 11 116600626 missense probably damaging 1.00
IGL02211:Rhbdf2 APN 11 116600435 missense possibly damaging 0.49
Lostnf UTSW 11 116600161 missense probably damaging 1.00
Lostnf2 UTSW 11 116600191 missense possibly damaging 0.94
sinecure UTSW 11 116602260 missense probably damaging 0.99
trapezoid UTSW 11 116601148 missense probably damaging 0.96
R0131:Rhbdf2 UTSW 11 116605344 missense probably damaging 1.00
R0399:Rhbdf2 UTSW 11 116603992 missense probably benign 0.00
R0739:Rhbdf2 UTSW 11 116600161 missense probably damaging 1.00
R1839:Rhbdf2 UTSW 11 116600191 missense possibly damaging 0.94
R2029:Rhbdf2 UTSW 11 116601148 missense probably damaging 0.96
R3833:Rhbdf2 UTSW 11 116604424 missense probably damaging 1.00
R4330:Rhbdf2 UTSW 11 116601956 missense probably benign
R4331:Rhbdf2 UTSW 11 116602296 missense probably damaging 1.00
R4872:Rhbdf2 UTSW 11 116601945 missense probably benign 0.04
R5530:Rhbdf2 UTSW 11 116600662 missense probably damaging 1.00
R5625:Rhbdf2 UTSW 11 116605377 missense probably damaging 0.99
R5841:Rhbdf2 UTSW 11 116602354 unclassified probably benign
R6579:Rhbdf2 UTSW 11 116604463 missense probably benign 0.02
R7047:Rhbdf2 UTSW 11 116603651 critical splice donor site probably null
X0027:Rhbdf2 UTSW 11 116599093 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCAGAGTTCAGAGCCTTGCTCC -3'
(R):5'- CCCGGCGAGTCTGAGATGTAAATC -3'

Sequencing Primer
(F):5'- CCCTGCAATCTTTCAGGCG -3'
(R):5'- ctcccccctcaccccac -3'
Posted On2014-05-23