Incidental Mutation 'R1756:Ighmbp2'
ID194913
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
MMRRC Submission 039788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1756 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3268669 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 469 (H469L)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025751
AA Change: H469L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: H469L

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119292
AA Change: H469L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: H469L

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143079
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,068,061 H382Q possibly damaging Het
A330008L17Rik C A 8: 99,421,882 noncoding transcript Het
Acin1 A G 14: 54,665,204 V377A probably benign Het
Adam39 A T 8: 40,825,324 I251F probably damaging Het
Adnp2 A T 18: 80,127,697 *1166K probably null Het
Akap12 T A 10: 4,357,574 D1461E probably benign Het
Apba1 A G 19: 23,893,692 D296G possibly damaging Het
Apol7a G T 15: 77,393,471 L26M possibly damaging Het
Bcl2 C T 1: 106,712,392 M163I probably damaging Het
Cap2 T G 13: 46,531,013 I53R probably benign Het
Ccdc105 T A 10: 78,747,197 K451M probably damaging Het
Ccdc74a T C 16: 17,650,468 V318A possibly damaging Het
Ccnb2 A G 9: 70,410,788 V234A probably benign Het
Cd207 C T 6: 83,675,597 V184I probably benign Het
Cdk12 C A 11: 98,241,761 C1005* probably null Het
Cep83 T C 10: 94,750,267 S344P probably damaging Het
Ces1g A T 8: 93,306,954 Y447N probably benign Het
Cfap54 A T 10: 93,048,061 L277Q probably damaging Het
Cfh A G 1: 140,100,877 Y1027H probably damaging Het
Clcnkb T A 4: 141,415,214 I28F possibly damaging Het
Clec4d A G 6: 123,267,109 D59G probably damaging Het
Colq G A 14: 31,547,452 P153S probably damaging Het
Crybg1 T A 10: 43,986,279 T1500S probably damaging Het
Cyp2d34 T A 15: 82,617,524 R262W probably damaging Het
Dennd4b C G 3: 90,271,605 L559V probably damaging Het
Dhrs1 A G 14: 55,739,309 V306A probably benign Het
Diaph1 A T 18: 37,854,573 D1043E possibly damaging Het
Dis3 G T 14: 99,086,103 D538E probably damaging Het
Dnaic2 T G 11: 114,750,380 S344A probably benign Het
Dner C T 1: 84,445,590 V431M probably damaging Het
Dnm1l A G 16: 16,342,695 probably null Het
Eps15 T G 4: 109,312,918 L139* probably null Het
Fam193a T A 5: 34,466,292 I55N possibly damaging Het
Gm10308 T A 17: 91,088,957 Y102* probably null Het
Gm10509 A G 17: 21,690,855 K30E possibly damaging Het
Gm4778 A T 3: 94,266,218 M174L probably benign Het
Gm9573 A T 17: 35,619,239 probably benign Het
Gpr155 T C 2: 73,367,577 M400V probably benign Het
H2-M10.2 T C 17: 36,286,123 probably benign Het
Heatr1 G T 13: 12,396,460 A61S probably benign Het
Helb G T 10: 120,094,242 T744K probably damaging Het
Hmcn1 C A 1: 150,599,030 W4702L probably damaging Het
Hmcn2 C T 2: 31,396,120 R2095W probably damaging Het
Igfbp3 G C 11: 7,208,461 D267E probably damaging Het
Kcnj3 A C 2: 55,437,220 K7T probably damaging Het
Krtap5-5 T G 7: 142,229,621 K97N unknown Het
Lcor T C 19: 41,559,266 S430P probably benign Het
Lpin1 A G 12: 16,538,540 V883A probably damaging Het
Lrp1b T C 2: 41,110,825 Y2243C probably damaging Het
Lrrc46 G A 11: 97,034,730 probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Ncbp1 T A 4: 46,169,131 L635* probably null Het
Nipbl T C 15: 8,338,551 N1202D possibly damaging Het
Nphs1 A G 7: 30,461,534 D196G probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1008 A G 2: 85,690,083 Y218C probably damaging Het
Olfr1360 A G 13: 21,674,695 I83T probably benign Het
Olfr901 A T 9: 38,430,995 I238F probably benign Het
Pax8 A T 2: 24,435,821 N350K probably damaging Het
Pik3cd T C 4: 149,658,750 K298E probably benign Het
Pkd1 C T 17: 24,594,485 R4000C probably damaging Het
Pkn2 A T 3: 142,810,727 V546D possibly damaging Het
Plcg2 A G 8: 117,592,708 K673E probably benign Het
Pld4 T G 12: 112,763,392 probably null Het
Plek A T 11: 16,992,901 N130K probably damaging Het
Prune2 G A 19: 17,123,704 D2191N probably benign Het
Ptgis T C 2: 167,206,803 Y431C probably damaging Het
Rhbdf2 T C 11: 116,607,266 S36G probably benign Het
Rtn4ip1 C T 10: 43,910,830 A178V probably damaging Het
Rxfp1 A G 3: 79,670,881 S168P probably benign Het
Sec24a A G 11: 51,733,763 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk6 C T 14: 110,750,552 M574I probably benign Het
Slk T C 19: 47,622,677 F861L probably damaging Het
Smpd3 C A 8: 106,264,971 A317S probably benign Het
Spz1 T A 13: 92,575,125 Q281L probably damaging Het
Syde1 T A 10: 78,586,980 R519S probably benign Het
Taf4 T C 2: 179,976,531 H39R unknown Het
Tbx5 A T 5: 119,845,113 probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Th G A 7: 142,898,166 Q19* probably null Het
Tmprss11a T A 5: 86,420,179 I230F probably damaging Het
Tnfrsf14 T A 4: 154,925,322 H50L possibly damaging Het
Tpp2 T A 1: 43,978,725 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim2 A G 3: 84,190,800 I398T possibly damaging Het
Trpc5 A T X: 144,481,226 S212T probably damaging Het
Ttn A G 2: 76,787,334 probably benign Het
Unc80 A G 1: 66,639,248 T2063A possibly damaging Het
Usp37 A T 1: 74,479,655 S260T probably benign Het
Vcan A G 13: 89,691,681 S1915P probably benign Het
Vmn1r33 T A 6: 66,612,298 I91F possibly damaging Het
Zfp422 T C 6: 116,626,424 T205A probably benign Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense not run
Predicted Primers PCR Primer
(F):5'- AGAACGCAAGACTGACTTCCTTCAC -3'
(R):5'- TTTTGGATACAGGGCGGCACTG -3'

Sequencing Primer
(F):5'- ACACAGAAGGGCTGCCG -3'
(R):5'- ACGGTACAGTACCGAATGCA -3'
Posted On2014-05-23