Incidental Mutation 'R1757:Dock10'
ID194923
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 039789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R1757 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80533869 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1508 (T1508A)
Ref Sequence ENSEMBL: ENSMUSP00000140719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably damaging
Transcript: ENSMUST00000077946
AA Change: T1521A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: T1521A

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187774
AA Change: T1509A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: T1509A

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189486
Predicted Effect probably damaging
Transcript: ENSMUST00000190595
AA Change: T1174A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: T1174A

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190983
AA Change: T1508A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: T1508A

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnah6 T C 6: 73,160,982 E913G probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 M1R probably null Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lama3 A G 18: 12,465,499 N988D probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Rrp9 T A 9: 106,483,004 C204S probably damaging Het
Shkbp1 T C 7: 27,342,351 T693A probably benign Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp455 T C 13: 67,207,537 S225P probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGCACACTGAGAGATGCAAAG -3'
(R):5'- GACCCTCTAAAGCACGGTTATCCAC -3'

Sequencing Primer
(F):5'- ATTGTCACCTTGAGCTGAGC -3'
(R):5'- CTGTATAAACTTCCCTGAGAGCG -3'
Posted On2014-05-23