Incidental Mutation 'R1757:Shkbp1'
ID194965
Institutional Source Beutler Lab
Gene Symbol Shkbp1
Ensembl Gene ENSMUSG00000089832
Gene NameSh3kbp1 binding protein 1
SynonymsB930062H15Rik, SB1
MMRRC Submission 039789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1757 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27342133-27356019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27342351 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 693 (T693A)
Ref Sequence ENSEMBL: ENSMUSP00000003857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003857] [ENSMUST00000038618] [ENSMUST00000108369]
Predicted Effect probably benign
Transcript: ENSMUST00000003857
AA Change: T693A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003857
Gene: ENSMUSG00000089832
AA Change: T693A

DomainStartEndE-ValueType
BTB 19 119 1.65e-16 SMART
low complexity region 183 194 N/A INTRINSIC
Blast:WD40 196 271 1e-21 BLAST
WD40 277 313 1.9e2 SMART
WD40 419 457 3.45e-1 SMART
WD40 527 577 3.68e1 SMART
low complexity region 612 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038618
SMART Domains Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
EGF 151 180 2.74e-3 SMART
low complexity region 244 265 N/A INTRINSIC
EGF_CA 356 396 3.51e-10 SMART
Pfam:TB 416 457 4.8e-15 PFAM
low complexity region 490 501 N/A INTRINSIC
low complexity region 507 568 N/A INTRINSIC
low complexity region 579 590 N/A INTRINSIC
EGF 591 629 6.06e-5 SMART
EGF_CA 630 671 8.3e-12 SMART
EGF_CA 672 713 7.34e-13 SMART
EGF_CA 714 751 8.43e-13 SMART
EGF_CA 753 794 1.66e-11 SMART
EGF_CA 795 836 3.61e-12 SMART
EGF_CA 837 876 5.61e-9 SMART
EGF_CA 877 919 1.73e-9 SMART
EGF_CA 920 961 7.12e-11 SMART
EGF_CA 962 1002 3.56e-11 SMART
EGF_CA 1003 1046 1.61e-9 SMART
EGF_CA 1047 1090 2.13e-9 SMART
EGF_CA 1091 1132 1.02e-11 SMART
EGF 1136 1175 1.69e1 SMART
low complexity region 1185 1223 N/A INTRINSIC
Pfam:TB 1234 1276 1.7e-13 PFAM
EGF_CA 1295 1337 2.72e-7 SMART
EGF_CA 1338 1379 1.36e-7 SMART
Pfam:TB 1402 1443 4.3e-14 PFAM
low complexity region 1449 1461 N/A INTRINSIC
low complexity region 1478 1500 N/A INTRINSIC
EGF 1578 1615 6.06e-5 SMART
EGF_CA 1616 1660 9.54e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108369
SMART Domains Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 116 145 N/A INTRINSIC
EGF 150 179 2.74e-3 SMART
low complexity region 243 264 N/A INTRINSIC
EGF_CA 355 395 3.51e-10 SMART
Pfam:TB 414 456 2.5e-14 PFAM
low complexity region 489 500 N/A INTRINSIC
low complexity region 506 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
EGF 590 628 6.06e-5 SMART
EGF_CA 629 670 8.3e-12 SMART
EGF_CA 671 712 7.34e-13 SMART
EGF_CA 713 750 8.43e-13 SMART
EGF_CA 752 793 1.66e-11 SMART
EGF_CA 794 835 3.61e-12 SMART
EGF_CA 836 875 5.61e-9 SMART
EGF_CA 876 918 1.73e-9 SMART
EGF_CA 919 960 7.12e-11 SMART
EGF_CA 961 1001 3.56e-11 SMART
EGF_CA 1002 1045 1.61e-9 SMART
EGF_CA 1046 1089 2.13e-9 SMART
EGF_CA 1090 1131 1.02e-11 SMART
EGF 1135 1174 1.69e1 SMART
low complexity region 1184 1222 N/A INTRINSIC
Pfam:TB 1232 1275 2.4e-13 PFAM
EGF_CA 1294 1336 2.72e-7 SMART
EGF_CA 1337 1378 1.36e-7 SMART
Pfam:TB 1400 1442 7.6e-15 PFAM
low complexity region 1448 1460 N/A INTRINSIC
low complexity region 1477 1499 N/A INTRINSIC
EGF 1577 1614 6.06e-5 SMART
EGF_CA 1615 1659 9.54e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148933
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnah6 T C 6: 73,160,982 E913G probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dock10 T C 1: 80,533,869 T1508A probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 M1R probably null Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lama3 A G 18: 12,465,499 N988D probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Rrp9 T A 9: 106,483,004 C204S probably damaging Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp455 T C 13: 67,207,537 S225P probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Shkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Shkbp1 APN 7 27355251 missense probably benign 0.28
IGL01469:Shkbp1 APN 7 27355941 missense probably benign
IGL01787:Shkbp1 APN 7 27342450 missense possibly damaging 0.93
IGL02149:Shkbp1 APN 7 27342639 unclassified probably benign
IGL02902:Shkbp1 APN 7 27342716 missense probably damaging 0.97
R0086:Shkbp1 UTSW 7 27352026 missense probably benign 0.00
R0219:Shkbp1 UTSW 7 27352061 missense probably benign 0.01
R0485:Shkbp1 UTSW 7 27348581 missense probably damaging 1.00
R1036:Shkbp1 UTSW 7 27345296 missense possibly damaging 0.86
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1608:Shkbp1 UTSW 7 27354779 missense probably benign 0.01
R1968:Shkbp1 UTSW 7 27355400 critical splice donor site probably null
R2763:Shkbp1 UTSW 7 27347029 missense probably benign 0.05
R3027:Shkbp1 UTSW 7 27343393 missense probably benign 0.18
R3924:Shkbp1 UTSW 7 27342402 missense probably benign
R4425:Shkbp1 UTSW 7 27343302 missense probably benign 0.38
R5048:Shkbp1 UTSW 7 27352096 unclassified probably benign
R5862:Shkbp1 UTSW 7 27343404 nonsense probably null
R5955:Shkbp1 UTSW 7 27342524 missense probably benign
R6016:Shkbp1 UTSW 7 27354401 missense possibly damaging 0.92
R6226:Shkbp1 UTSW 7 27351980 missense probably null 1.00
R6362:Shkbp1 UTSW 7 27351695 critical splice donor site probably null
R6382:Shkbp1 UTSW 7 27352059 nonsense probably null
R6460:Shkbp1 UTSW 7 27350538 missense probably benign 0.01
R6647:Shkbp1 UTSW 7 27342375 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACCTGGCGACACAGATTACAC -3'
(R):5'- ATGTGAGCTGAGCCCATTGGCTTC -3'

Sequencing Primer
(F):5'- GATTACACCAAGGAGCCCCTG -3'
(R):5'- AGGACCTCTCTTACCAGGTAGC -3'
Posted On2014-05-23