Incidental Mutation 'R1757:Zfp455'
Institutional Source Beutler Lab
Gene Symbol Zfp455
Ensembl Gene ENSMUSG00000051037
Gene Namezinc finger protein 455
SynonymsRslcan-10, 3732412P20Rik
MMRRC Submission 039789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R1757 (G1)
Quality Score225
Status Validated
Chromosomal Location67194506-67209298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67207537 bp
Amino Acid Change Serine to Proline at position 225 (S225P)
Ref Sequence ENSEMBL: ENSMUSP00000113356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117110] [ENSMUST00000120861]
Predicted Effect probably damaging
Transcript: ENSMUST00000117110
AA Change: S225P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113356
Gene: ENSMUSG00000051037
AA Change: S225P

ZnF_C2H2 44 66 7.15e-2 SMART
ZnF_C2H2 72 94 1.6e-4 SMART
ZnF_C2H2 100 122 2.12e-4 SMART
ZnF_C2H2 128 150 6.23e-2 SMART
ZnF_C2H2 184 206 1.01e-1 SMART
ZnF_C2H2 212 234 3.11e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 318 3.58e-2 SMART
ZnF_C2H2 324 346 2.24e-3 SMART
ZnF_C2H2 352 374 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120861
AA Change: S290P

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112546
Gene: ENSMUSG00000051037
AA Change: S290P

KRAB 5 65 1.92e-34 SMART
ZnF_C2H2 109 131 7.15e-2 SMART
ZnF_C2H2 137 159 1.6e-4 SMART
ZnF_C2H2 165 187 2.12e-4 SMART
ZnF_C2H2 193 215 6.23e-2 SMART
ZnF_C2H2 249 271 1.01e-1 SMART
ZnF_C2H2 277 299 3.11e-2 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.58e-2 SMART
ZnF_C2H2 389 411 2.24e-3 SMART
ZnF_C2H2 417 439 7.9e-4 SMART
Meta Mutation Damage Score 0.0344 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnah6 T C 6: 73,160,982 E913G probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dock10 T C 1: 80,533,869 T1508A probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 M1R probably null Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lama3 A G 18: 12,465,499 N988D probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Rrp9 T A 9: 106,483,004 C204S probably damaging Het
Shkbp1 T C 7: 27,342,351 T693A probably benign Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Zfp455
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zfp455 APN 13 67207898 missense probably benign 0.33
IGL03111:Zfp455 APN 13 67207999 missense probably benign 0.00
IGL03210:Zfp455 APN 13 67207049 missense possibly damaging 0.93
IGL03371:Zfp455 APN 13 67207002 nonsense probably null
R0245:Zfp455 UTSW 13 67207835 missense probably damaging 1.00
R0277:Zfp455 UTSW 13 67198664 splice site probably null
R1141:Zfp455 UTSW 13 67198591 missense probably damaging 1.00
R1266:Zfp455 UTSW 13 67206964 nonsense probably null
R1657:Zfp455 UTSW 13 67198639 missense possibly damaging 0.83
R1749:Zfp455 UTSW 13 67207009 missense probably damaging 1.00
R1854:Zfp455 UTSW 13 67207817 missense probably damaging 1.00
R1867:Zfp455 UTSW 13 67207445 missense probably benign 0.33
R4411:Zfp455 UTSW 13 67207325 missense probably damaging 0.96
R6060:Zfp455 UTSW 13 67207193 missense probably damaging 1.00
R6544:Zfp455 UTSW 13 67207057 missense probably benign 0.33
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- TACCCCTTCAGGAAcatgagc -3'
(R):5'- agggatgagtgataacgaaagg -3'
Posted On2014-05-23