Incidental Mutation 'R1757:Lama3'
ID195029
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
MMRRC Submission 039789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1757 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12465499 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 988 (N988D)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070]
Predicted Effect probably benign
Transcript: ENSMUST00000092070
AA Change: N988D

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: N988D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 100% (111/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 A T 14: 8,049,867 I219F probably damaging Het
Acvr1b A G 15: 101,198,822 I207V possibly damaging Het
Adamtsl4 T C 3: 95,677,942 T839A probably benign Het
Akap1 C T 11: 88,845,752 R61H probably damaging Het
Akap9 A G 5: 4,001,667 D1478G probably benign Het
Aloxe3 T A 11: 69,135,949 V547E possibly damaging Het
Ano6 G A 15: 95,962,267 A757T probably damaging Het
Armc10 A G 5: 21,653,457 T167A probably damaging Het
BB019430 A C 10: 58,704,047 noncoding transcript Het
Brms1 C T 19: 5,046,407 R82W probably damaging Het
Btnl6 G A 17: 34,514,088 T267I probably benign Het
Catsper4 A T 4: 134,217,901 F215L probably benign Het
Ccdc105 T C 10: 78,747,224 N442S probably benign Het
Ccdc188 T C 16: 18,218,688 F197S probably damaging Het
Cers5 A C 15: 99,736,331 C379G probably benign Het
Chchd6 A G 6: 89,384,644 L259P probably damaging Het
Cntnap2 T A 6: 46,759,829 C730S probably damaging Het
Coch T G 12: 51,602,848 V314G probably damaging Het
Cog1 T A 11: 113,652,304 S213T possibly damaging Het
Crot A T 5: 8,987,828 F163I probably damaging Het
Cyp4f13 A T 17: 32,929,958 I162N probably damaging Het
Dab2 A T 15: 6,330,452 probably benign Het
Depdc1b C T 13: 108,323,948 R31W probably damaging Het
Dlk1 T C 12: 109,459,687 F161S probably damaging Het
Dnah6 T C 6: 73,160,982 E913G probably damaging Het
Dnajc6 A G 4: 101,597,831 Y5C probably damaging Het
Dock10 T C 1: 80,533,869 T1508A probably damaging Het
Dstyk A G 1: 132,434,094 probably benign Het
Efcc1 T C 6: 87,749,283 probably benign Het
Entpd1 T C 19: 40,739,006 Y533H probably benign Het
Epha8 A T 4: 136,931,478 probably null Het
Erich3 C T 3: 154,695,765 T17M probably damaging Het
Ethe1 T C 7: 24,608,474 probably benign Het
Fbxw15 A T 9: 109,557,279 M211K probably damaging Het
Fhod3 G A 18: 25,066,278 V669M possibly damaging Het
Fktn C T 4: 53,747,003 probably benign Het
Foxred1 G A 9: 35,210,834 R20C probably benign Het
Gbp9 A G 5: 105,094,453 L140P probably damaging Het
Gga1 T C 15: 78,889,030 L286P probably damaging Het
Gm11397 T C 13: 33,399,353 S150P probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gsap A T 5: 21,281,037 K628N probably damaging Het
Gtf3c4 G A 2: 28,830,636 probably benign Het
H2-M10.6 A C 17: 36,813,151 Y169S probably benign Het
Hal G A 10: 93,494,628 V245I probably benign Het
Hebp2 T C 10: 18,545,101 Y72C probably damaging Het
Helz2 T C 2: 181,236,263 E914G probably damaging Het
Herc3 T C 6: 58,916,470 Y906H probably damaging Het
Hfm1 A T 5: 106,880,360 probably null Het
Hgs C T 11: 120,480,063 P582S probably damaging Het
Hoxa10 G A 6: 52,234,489 P149L probably damaging Het
Inpp5j T A 11: 3,504,738 Q4L possibly damaging Het
Ints8 A C 4: 11,254,109 M1R probably null Het
Isg15 T C 4: 156,199,990 E27G possibly damaging Het
Klf13 A T 7: 63,891,765 C205S probably damaging Het
Lama1 G A 17: 67,697,383 V17M unknown Het
Lama1 A T 17: 67,763,836 Y830F probably benign Het
Lcat CAT C 8: 105,941,814 probably null Het
Lct G T 1: 128,301,257 P833H probably damaging Het
Lmf1 A T 17: 25,655,210 R403W probably damaging Het
Me3 T G 7: 89,633,022 S38A probably benign Het
Myg1 A T 15: 102,331,829 D30V probably benign Het
Nbea A G 3: 55,630,189 I2841T possibly damaging Het
Nek1 T A 8: 61,089,813 probably null Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr1158 T G 2: 87,990,582 I157R probably damaging Het
Olfr1198 G T 2: 88,746,017 D290E probably benign Het
Olfr1475 A C 19: 13,479,607 V197G possibly damaging Het
Olfr430 A T 1: 174,069,658 Y120F probably damaging Het
Osbpl9 A G 4: 109,064,583 Y613H probably damaging Het
Per3 C T 4: 151,042,792 probably null Het
Pex6 G T 17: 46,723,498 V758L probably damaging Het
Pikfyve A G 1: 65,252,548 I1309V probably damaging Het
Pimreg A G 11: 72,043,159 E37G possibly damaging Het
Pjvk G A 2: 76,655,888 V211I probably benign Het
Plekhg4 T A 8: 105,381,661 V1112E probably damaging Het
Ptprz1 T A 6: 23,044,320 M2106K probably damaging Het
Rdh16f2 G T 10: 127,876,896 L254F probably benign Het
Rictor G A 15: 6,773,862 R485Q possibly damaging Het
Rnf146 G A 10: 29,347,479 T137M probably damaging Het
Rrp9 T A 9: 106,483,004 C204S probably damaging Het
Shkbp1 T C 7: 27,342,351 T693A probably benign Het
Skint9 A G 4: 112,413,962 Y84H probably benign Het
Slc22a12 A T 19: 6,536,731 probably null Het
Slfn4 T C 11: 83,185,385 C26R possibly damaging Het
Snrnp200 T C 2: 127,232,443 L1401P probably damaging Het
Specc1 T A 11: 62,119,284 probably null Het
Spef2 A T 15: 9,717,482 M316K probably damaging Het
Tbc1d22b A G 17: 29,571,673 R204G probably damaging Het
Tgfbr3l C A 8: 4,249,548 D110E probably benign Het
Ticrr T G 7: 79,675,323 S532R probably damaging Het
Ticrr C A 7: 79,679,046 Y644* probably null Het
Tmem5 T C 10: 122,089,015 T261A probably benign Het
Traf3ip1 A T 1: 91,522,857 T509S probably damaging Het
Trmt10b T C 4: 45,307,946 Y209H probably damaging Het
Trmt6 T C 2: 132,810,237 M172V probably damaging Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Tshz2 C A 2: 169,883,923 F146L probably benign Het
Tspyl4 G T 10: 34,297,580 E23* probably null Het
Ulk2 A T 11: 61,841,339 probably benign Het
Umodl1 A T 17: 31,008,700 I1336F probably damaging Het
Vezt T C 10: 93,970,563 D662G probably benign Het
Vnn1 A T 10: 23,900,828 Q359L possibly damaging Het
Vnn1 G T 10: 23,900,829 Q359H probably benign Het
Zdhhc16 A G 19: 41,941,955 N14S probably damaging Het
Zfp455 T C 13: 67,207,537 S225P probably damaging Het
Zfp74 T A 7: 29,935,061 E407D probably benign Het
Zic2 T A 14: 122,478,619 H384Q possibly damaging Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
Camelid UTSW 18 12419257 critical splice donor site probably null
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6060:Lama3 UTSW 18 12556663 missense probably damaging 0.99
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTCCTCTCTGGCAGGTAGAACTG -3'
(R):5'- AGTAAGCCCTTGGCAATTAGCACTC -3'

Sequencing Primer
(F):5'- TGGTGGACGTGAATCTGAAG -3'
(R):5'- GCACTCTTGGGCAAAAAGTTC -3'
Posted On2014-05-23