Incidental Mutation 'R1758:Slc22a15'
ID195059
Institutional Source Beutler Lab
Gene Symbol Slc22a15
Ensembl Gene ENSMUSG00000033147
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 15
SynonymsA530052I06Rik, 2610034P21Rik
MMRRC Submission 039790-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1758 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location101855776-101924453 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 101860453 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 386 (Q386*)
Ref Sequence ENSEMBL: ENSMUSP00000139518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106928] [ENSMUST00000183255] [ENSMUST00000190824]
Predicted Effect probably null
Transcript: ENSMUST00000106928
AA Change: Q541*
SMART Domains Protein: ENSMUSP00000102541
Gene: ENSMUSG00000033147
AA Change: Q541*

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 58 495 6.9e-29 PFAM
Pfam:MFS_1 69 450 3.4e-24 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182130
Predicted Effect probably benign
Transcript: ENSMUST00000183255
SMART Domains Protein: ENSMUSP00000138357
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 56 244 5.2e-13 PFAM
Pfam:MFS_1 69 244 7.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183293
Predicted Effect probably null
Transcript: ENSMUST00000190824
AA Change: Q386*
SMART Domains Protein: ENSMUSP00000139518
Gene: ENSMUSG00000033147
AA Change: Q386*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Sugar_tr 88 341 3.3e-5 PFAM
low complexity region 369 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Organic ion transporters, such as SLC22A15, transport various medically and physiologically important compounds, including pharmaceuticals, toxins, hormones, neurotransmitters, and cellular metabolites. These transporters are also referred to as amphiphilic solute facilitators (ASFs).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,562,237 R38G possibly damaging Het
4930590J08Rik T C 6: 91,915,222 V155A possibly damaging Het
Adgb A G 10: 10,426,605 S406P probably damaging Het
Adgrb2 C A 4: 130,011,875 T893N probably damaging Het
Adgrf5 T C 17: 43,424,593 probably null Het
Alms1 T A 6: 85,628,505 I2379N probably damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf4 C T 15: 80,257,213 T268I probably benign Het
BC067074 A G 13: 113,368,732 T2132A possibly damaging Het
Ccdc154 T C 17: 25,163,182 L25P probably damaging Het
Ccdc9 G A 7: 16,276,236 S381F probably damaging Het
Cdk17 C T 10: 93,208,250 T17M probably damaging Het
Cep128 T C 12: 91,347,578 N142S probably benign Het
Cep78 A G 19: 15,959,536 I602T probably damaging Het
Clasp1 C T 1: 118,548,025 T935I probably damaging Het
Cnr1 T C 4: 33,945,000 S463P probably damaging Het
Cntnap1 T A 11: 101,184,623 W876R probably damaging Het
Cntnap5c A G 17: 58,042,550 D286G probably damaging Het
Copa C T 1: 172,104,144 R321C probably damaging Het
Ctla2a T G 13: 60,935,442 E98A probably damaging Het
Cux1 A T 5: 136,392,322 D183E probably damaging Het
Cxcl15 A C 5: 90,801,464 T163P unknown Het
Ddias T C 7: 92,859,363 N448S probably benign Het
Dhx8 T C 11: 101,766,738 F1152S probably damaging Het
Dnah12 C A 14: 26,766,114 Q992K probably benign Het
Eno3 G T 11: 70,661,425 W301L possibly damaging Het
Faap100 A T 11: 120,377,233 V238E probably damaging Het
Fgf4 A G 7: 144,862,312 S137G probably benign Het
Fhod3 A C 18: 25,120,310 D1439A possibly damaging Het
Frem2 A G 3: 53,653,357 L1243P probably damaging Het
Gif G A 19: 11,757,815 M266I probably damaging Het
Gkn3 T G 6: 87,388,835 M1L probably benign Het
Gm10250 T C 15: 5,121,027 probably benign Het
Gm12185 T C 11: 48,908,032 T545A possibly damaging Het
Gm14226 T A 2: 155,025,458 L445H probably damaging Het
Gm3404 A T 5: 146,526,226 M73L probably benign Het
Gm4907 A G X: 23,906,751 I164V probably benign Het
Gm973 G T 1: 59,634,010 R976S unknown Het
Gpr146 A T 5: 139,393,382 H313L probably benign Het
Gys2 T A 6: 142,472,706 E32D probably damaging Het
Igsf10 G A 3: 59,329,196 T1188I probably benign Het
Igsf9b A T 9: 27,334,252 T1172S possibly damaging Het
Itga8 T A 2: 12,265,333 N114I possibly damaging Het
Itsn2 T A 12: 4,658,160 V795E possibly damaging Het
Kdm1b T A 13: 47,060,768 S197T probably benign Het
Kif5c G A 2: 49,723,133 R161Q probably benign Het
Krt33b T C 11: 100,025,535 Y232C probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrp1 A T 10: 127,588,584 N744K possibly damaging Het
Mcm10 C A 2: 5,004,050 L369F probably damaging Het
Muc5ac T A 7: 141,801,531 I1018N possibly damaging Het
Myom2 T C 8: 15,065,795 L70P probably benign Het
Myt1l T A 12: 29,827,242 N297K unknown Het
Ncr1 C T 7: 4,340,808 T98I probably benign Het
Nek3 T C 8: 22,160,262 E78G probably damaging Het
Nfatc3 T A 8: 106,099,136 N606K probably damaging Het
Nup107 T G 10: 117,761,343 D669A probably damaging Het
Olfr1113 A T 2: 87,213,414 Q174L probably benign Het
Olfr1264 T C 2: 90,021,329 T246A probably benign Het
Olfr922 A T 9: 38,815,575 H24L probably benign Het
Olfr95 A T 17: 37,211,313 I180N possibly damaging Het
Pcnx T C 12: 81,983,484 V1711A probably benign Het
Pik3c3 A G 18: 30,277,010 D99G probably damaging Het
Pinx1 C A 14: 63,919,575 T317K probably benign Het
Ppargc1b G T 18: 61,298,786 probably null Het
Pradc1 T A 6: 85,447,221 I119F possibly damaging Het
Psat1 G T 19: 15,914,879 T242K probably damaging Het
Psma6 G A 12: 55,407,532 C28Y probably damaging Het
Pyurf A T 6: 57,691,832 C58* probably null Het
Rab3gap2 C A 1: 185,283,884 A1331E probably benign Het
Rnase4 T C 14: 51,105,265 *149Q probably null Het
Ruvbl2 T C 7: 45,425,162 K184R probably benign Het
Scn7a T G 2: 66,680,183 M1292L probably benign Het
Scn7a A T 2: 66,700,887 Y549N probably damaging Het
Selp A G 1: 164,132,285 D370G possibly damaging Het
Slc22a29 A G 19: 8,217,762 probably null Het
Slc26a7 A C 4: 14,548,491 I266S possibly damaging Het
Smpd4 T C 16: 17,626,008 S112P probably damaging Het
Smpd4 T A 16: 17,640,880 L165Q probably damaging Het
Snx33 A G 9: 56,926,698 I29T probably benign Het
Spen G A 4: 141,476,375 P1647L unknown Het
Strip2 T C 6: 29,941,941 probably null Het
Swsap1 C T 9: 21,955,984 R75* probably null Het
Tmem210 C T 2: 25,288,423 T32I probably damaging Het
Tnn C T 1: 160,147,584 R91H possibly damaging Het
Tnni1 G A 1: 135,808,682 R94H probably damaging Het
Tnrc6c T A 11: 117,760,730 V1693D probably benign Het
Trip4 G A 9: 65,874,977 Q158* probably null Het
Ttc39b T C 4: 83,237,349 E474G probably damaging Het
Usp50 C A 2: 126,775,862 C221F probably damaging Het
Vmn1r171 T C 7: 23,632,356 I2T probably benign Het
Wdr62 T A 7: 30,267,903 I309F probably damaging Het
Xdh A T 17: 73,910,209 V688E probably damaging Het
Zfyve26 A G 12: 79,238,944 L2353P probably damaging Het
Zgpat C A 2: 181,378,840 R269S probably damaging Het
Other mutations in Slc22a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Slc22a15 APN 3 101860820 missense probably benign 0.00
IGL01120:Slc22a15 APN 3 101897166 missense probably damaging 1.00
IGL01345:Slc22a15 APN 3 101880176 missense probably benign 0.00
IGL01871:Slc22a15 APN 3 101860794 splice site probably benign
IGL01880:Slc22a15 APN 3 101860848 missense probably benign 0.32
R0310:Slc22a15 UTSW 3 101860511 missense probably benign 0.12
R1937:Slc22a15 UTSW 3 101880189 critical splice acceptor site probably null
R3804:Slc22a15 UTSW 3 101897274 missense probably damaging 1.00
R4830:Slc22a15 UTSW 3 101875603 intron probably benign
R5564:Slc22a15 UTSW 3 101864589 missense probably benign 0.34
R5684:Slc22a15 UTSW 3 101862955 missense probably damaging 1.00
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6114:Slc22a15 UTSW 3 101860852 nonsense probably null
R6481:Slc22a15 UTSW 3 101883583 missense possibly damaging 0.88
R6641:Slc22a15 UTSW 3 101875706 missense possibly damaging 0.52
R6945:Slc22a15 UTSW 3 101924114 missense probably damaging 0.99
R7354:Slc22a15 UTSW 3 101864581 missense probably benign 0.09
R7373:Slc22a15 UTSW 3 101877897 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CAGGGATGCTTGCTAGGAAGATGAC -3'
(R):5'- AGCAAAATTGCACTGTGAGTGCC -3'

Sequencing Primer
(F):5'- GCTTGCTAGGAAGATGACATCTC -3'
(R):5'- CTGGGTGGTAATTCTCATTAAGGC -3'
Posted On2014-05-23