Incidental Mutation 'R1759:Speg'
ID195149
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75401162 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 855 (M855L)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: M855L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: M855L

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113587
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113588
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113589
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113590
AA Change: M749L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: M749L

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122266
AA Change: M1L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132100
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: M602L
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTCTAAAGCCATCAGTGGCTCTTC -3'
(R):5'- ATGCCAAAGCATCAGGGGTGAC -3'

Sequencing Primer
(F):5'- CTAACATGAGGATAGGCTTTGGC -3'
(R):5'- TCCAGGTCACAAGGGTTAACG -3'
Posted On2014-05-23