Incidental Mutation 'R0077:Nlrc4'
ID19516
Institutional Source Beutler Lab
Gene Symbol Nlrc4
Ensembl Gene ENSMUSG00000039193
Gene NameNLR family, CARD domain containing 4
SynonymsCard12, Ipaf, 9530011P19Rik
MMRRC Submission 038364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0077 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74426295-74459108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74446831 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 186 (W186R)
Ref Sequence ENSEMBL: ENSMUSP00000059637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052124]
PDB Structure
Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000052124
AA Change: W186R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: W186R

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,771,685 probably benign Het
Adgrl4 A G 3: 151,517,781 I624V probably damaging Het
AI661453 A G 17: 47,469,362 probably benign Het
Alg12 C T 15: 88,815,978 E60K probably damaging Het
Angel2 A T 1: 190,933,087 N72Y possibly damaging Het
Ank1 C A 8: 23,140,167 P81Q probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Bpi T A 2: 158,261,334 M83K probably damaging Het
Capn7 A G 14: 31,368,115 I642V probably benign Het
Ccdc134 T C 15: 82,131,737 probably benign Het
Ccr3 C T 9: 124,029,024 T132I probably damaging Het
Cfap65 C A 1: 74,931,918 W80C probably damaging Het
Chaf1a T A 17: 56,047,384 I218K unknown Het
Ddx23 A G 15: 98,656,600 probably null Het
Dmkn A G 7: 30,765,294 S231G probably benign Het
Ep300 T C 15: 81,641,313 I1446T unknown Het
Fmnl1 T C 11: 103,189,969 F318S probably damaging Het
Grik5 A T 7: 25,023,380 V497E probably damaging Het
Gtf2ird2 T C 5: 134,214,083 Y380H probably damaging Het
Hecw2 C T 1: 53,868,831 probably benign Het
Hspb7 A G 4: 141,424,047 I167V probably damaging Het
Kcnh2 T A 5: 24,322,702 N884I probably benign Het
Krba1 T C 6: 48,405,225 probably benign Het
Krt18 G T 15: 102,030,974 R294L probably benign Het
Lctl T A 9: 64,122,107 M1K probably null Het
Lingo2 G A 4: 35,708,375 S535F possibly damaging Het
Lrba A C 3: 86,542,688 N2105H probably damaging Het
Lrrc10 A G 10: 117,045,514 D31G probably damaging Het
Lrrtm1 T A 6: 77,243,872 V104E probably damaging Het
Mgat3 C T 15: 80,212,577 T535I probably benign Het
Nav3 T C 10: 109,716,642 I1780V possibly damaging Het
Nr2c1 T A 10: 94,188,255 F441I probably benign Het
Obscn A G 11: 59,051,521 probably benign Het
Olfr221 T C 14: 52,035,985 N42S possibly damaging Het
Olfr444 T C 6: 42,955,773 S92P probably benign Het
Olfr59 T C 11: 74,288,675 F10L probably benign Het
Olfr688 T C 7: 105,288,519 V142A probably damaging Het
Osr1 A T 12: 9,579,691 Y188F probably damaging Het
Pak2 A T 16: 32,033,843 N293K possibly damaging Het
Pappa A T 4: 65,307,812 T1301S probably damaging Het
Pde4dip G A 3: 97,753,126 Q679* probably null Het
Pik3r5 T A 11: 68,486,622 probably null Het
Plbd2 C T 5: 120,486,039 probably null Het
Ppp1r3a G T 6: 14,754,517 P244T possibly damaging Het
Pum1 C A 4: 130,772,674 R960S probably benign Het
Ralgapb T C 2: 158,473,249 Y845H probably damaging Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Rdh1 A T 10: 127,760,037 I34F probably damaging Het
Rgl3 T A 9: 21,974,102 Q644L probably benign Het
Rpap2 T C 5: 107,620,474 S393P probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
S100a11 A C 3: 93,524,202 probably null Het
Sept4 T C 11: 87,581,196 S11P probably benign Het
Serpina1c T C 12: 103,896,091 S322G probably benign Het
Setdb1 A T 3: 95,341,451 C385S probably damaging Het
Shank2 A T 7: 144,192,467 I193F possibly damaging Het
Slc4a11 G T 2: 130,686,301 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tbcd C A 11: 121,594,274 Q761K probably benign Het
Tmed6 C T 8: 107,065,566 V16M probably damaging Het
Tmem229a T C 6: 24,955,702 T18A probably benign Het
Tsc1 T A 2: 28,678,943 probably benign Het
Ube2m T C 7: 13,035,730 N49D probably damaging Het
Ubqlnl T C 7: 104,150,047 D81G probably damaging Het
Vmn2r56 A G 7: 12,715,405 V302A probably benign Het
Vmn2r73 T A 7: 85,875,867 R24S probably benign Het
Wfs1 C A 5: 36,973,194 S236I probably damaging Het
Xpot A T 10: 121,605,639 N560K probably benign Het
Yipf3 A G 17: 46,251,577 T303A probably benign Het
Zfp790 T C 7: 29,824,875 W19R probably damaging Het
Zfp846 T C 9: 20,594,007 C388R probably benign Het
Zpr1 T A 9: 46,273,336 I47N probably damaging Het
Other mutations in Nlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nlrc4 APN 17 74446534 missense probably benign 0.02
IGL00427:Nlrc4 APN 17 74447092 missense probably benign
IGL00823:Nlrc4 APN 17 74447990 missense probably benign 0.01
IGL01404:Nlrc4 APN 17 74445711 missense probably damaging 1.00
IGL02178:Nlrc4 APN 17 74446843 missense probably damaging 1.00
IGL02266:Nlrc4 APN 17 74446167 missense possibly damaging 0.72
IGL03342:Nlrc4 APN 17 74445318 missense probably damaging 1.00
inwood UTSW 17 74445630 missense probably damaging 1.00
PIT4305001:Nlrc4 UTSW 17 74446309 missense probably damaging 0.99
PIT4466001:Nlrc4 UTSW 17 74427119 missense probably benign 0.01
R0398:Nlrc4 UTSW 17 74445920 missense probably damaging 0.99
R0639:Nlrc4 UTSW 17 74426963 missense probably benign 0.16
R1498:Nlrc4 UTSW 17 74446413 missense probably benign 0.43
R1565:Nlrc4 UTSW 17 74441931 missense probably benign 0.00
R1624:Nlrc4 UTSW 17 74445189 missense possibly damaging 0.55
R1666:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1668:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1690:Nlrc4 UTSW 17 74437523 nonsense probably null
R1723:Nlrc4 UTSW 17 74441908 missense probably damaging 1.00
R1988:Nlrc4 UTSW 17 74426943 missense probably benign 0.09
R1992:Nlrc4 UTSW 17 74445633 missense probably benign 0.04
R2141:Nlrc4 UTSW 17 74447951 splice site probably benign
R2256:Nlrc4 UTSW 17 74445630 missense probably damaging 1.00
R2897:Nlrc4 UTSW 17 74448045 missense probably benign
R3117:Nlrc4 UTSW 17 74436068 missense probably benign 0.00
R3861:Nlrc4 UTSW 17 74445621 missense probably benign 0.00
R4093:Nlrc4 UTSW 17 74445958 missense probably benign 0.20
R4212:Nlrc4 UTSW 17 74447115 missense possibly damaging 0.66
R4627:Nlrc4 UTSW 17 74446628 missense probably damaging 1.00
R4859:Nlrc4 UTSW 17 74436037 missense probably damaging 0.97
R4968:Nlrc4 UTSW 17 74446941 missense probably benign 0.20
R5133:Nlrc4 UTSW 17 74446717 missense possibly damaging 0.91
R5379:Nlrc4 UTSW 17 74448083 nonsense probably null
R6045:Nlrc4 UTSW 17 74446959 missense probably damaging 0.98
R6654:Nlrc4 UTSW 17 74445528 missense possibly damaging 0.55
R6712:Nlrc4 UTSW 17 74446836 missense probably damaging 0.96
R6976:Nlrc4 UTSW 17 74445939 missense probably damaging 1.00
R7030:Nlrc4 UTSW 17 74446006 missense probably damaging 1.00
R7153:Nlrc4 UTSW 17 74447103 missense possibly damaging 0.84
R7190:Nlrc4 UTSW 17 74445203 missense probably damaging 1.00
R7398:Nlrc4 UTSW 17 74446542 missense probably damaging 1.00
R7417:Nlrc4 UTSW 17 74446488 missense probably benign 0.18
R7468:Nlrc4 UTSW 17 74445512 missense probably benign 0.00
X0026:Nlrc4 UTSW 17 74446643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTAGCTTCAGCAGCAGAGCC -3'
(R):5'- GAGCTTTGAGATGCAAATCATGCCG -3'

Sequencing Primer
(F):5'- CAGCAGAGCCTTGAAGGTC -3'
(R):5'- AAGACCTGAATGTTTTGGCCC -3'
Posted On2013-04-11