Incidental Mutation 'R1759:Sgce'
ID195178
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4689765 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 356 (I356N)
Ref Sequence ENSEMBL: ENSMUSP00000121964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect probably damaging
Transcript: ENSMUST00000004750
AA Change: I347N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631
AA Change: I347N

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090686
AA Change: I347N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631
AA Change: I347N

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101677
AA Change: I347N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631
AA Change: I347N

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115577
AA Change: I392N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: I392N

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115579
AA Change: I356N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631
AA Change: I356N

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126151
AA Change: I315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631
AA Change: I315N

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128109
Predicted Effect probably damaging
Transcript: ENSMUST00000133306
AA Change: I356N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631
AA Change: I356N

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153284
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
PIT4445001:Sgce UTSW 6 4689654 missense possibly damaging 0.85
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1630:Sgce UTSW 6 4719476 missense probably damaging 0.98
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R3429:Sgce UTSW 6 4730008 missense probably benign 0.01
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4427:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4921:Sgce UTSW 6 4694153 missense probably damaging 1.00
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6271:Sgce UTSW 6 4730015 missense possibly damaging 0.81
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCACTGCTGTGCCTGCATCAAC -3'
(R):5'- AAAGGGCTCAAAAGCTAAGGCTACC -3'

Sequencing Primer
(F):5'- AACCTCTCCAGTTACAGGGT -3'
(R):5'- GGCAACTCATTACGGCTAGT -3'
Posted On2014-05-23