Incidental Mutation 'R1759:Sorbs2'
ID195187
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Namesorbin and SH3 domain containing 2
Synonyms
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45507788-45827906 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 45763019 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 50 (*50C)
Ref Sequence ENSEMBL: ENSMUSP00000148072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000124544] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000134675] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139103] [ENSMUST00000139869] [ENSMUST00000141039] [ENSMUST00000143820] [ENSMUST00000149752] [ENSMUST00000150102] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000210946] [ENSMUST00000211095]
Predicted Effect probably benign
Transcript: ENSMUST00000067065
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
AA Change: D132V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: D132V

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124544
AA Change: D78V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000125295
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
AA Change: D78V

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626
AA Change: D78V

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132139
AA Change: D109V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626
AA Change: D109V

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect probably benign
Transcript: ENSMUST00000134675
AA Change: D109V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118160
Gene: ENSMUSG00000031626
AA Change: D109V

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect probably benign
Transcript: ENSMUST00000135336
AA Change: D132V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: D132V

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
AA Change: D132V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626
AA Change: D132V

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139103
Predicted Effect probably damaging
Transcript: ENSMUST00000139869
AA Change: D101V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626
AA Change: D101V

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141039
AA Change: D109V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117544
Gene: ENSMUSG00000031626
AA Change: D109V

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143820
AA Change: D78V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119539
Gene: ENSMUSG00000031626
AA Change: D78V

DomainStartEndE-ValueType
Sorb 113 163 9.63e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149752
Predicted Effect probably benign
Transcript: ENSMUST00000150102
Predicted Effect probably benign
Transcript: ENSMUST00000153798
AA Change: D101V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626
AA Change: D101V

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171337
AA Change: D132V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: D132V

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210946
Predicted Effect probably null
Transcript: ENSMUST00000211095
AA Change: *50C
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 45799706 splice site probably null
IGL00964:Sorbs2 APN 8 45795677 missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 45745423 missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 45795594 missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 45795344 missense probably null
IGL01662:Sorbs2 APN 8 45803829 splice site probably benign
IGL01970:Sorbs2 APN 8 45745803 missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 45823749 missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 45803840 missense probably benign 0.00
IGL03036:Sorbs2 APN 8 45782865 missense probably benign
IGL03151:Sorbs2 APN 8 45799713 missense probably benign 0.01
IGL03164:Sorbs2 APN 8 45782874 missense probably benign 0.01
IGL03350:Sorbs2 APN 8 45805807 missense probably damaging 0.99
R0058:Sorbs2 UTSW 8 45785254 splice site probably null
R0058:Sorbs2 UTSW 8 45796263 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 45785337 splice site probably benign
R0306:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R0308:Sorbs2 UTSW 8 45795130 nonsense probably null
R0638:Sorbs2 UTSW 8 45796310 missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 45796502 missense probably benign 0.39
R1110:Sorbs2 UTSW 8 45795730 missense probably benign 0.13
R1160:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 45795619 missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 45795967 missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 45789963 splice site probably benign
R1514:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 45759197 splice site probably benign
R1582:Sorbs2 UTSW 8 45805777 missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 45769854 missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 45800984 missense probably damaging 1.00
R1766:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 45805696 missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 45796352 missense probably benign 0.01
R1954:Sorbs2 UTSW 8 45745738 missense probably benign 0.23
R2060:Sorbs2 UTSW 8 45775629 missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 45795443 missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 45795370 nonsense probably null
R3812:Sorbs2 UTSW 8 45763030 missense probably benign 0.00
R3831:Sorbs2 UTSW 8 45795095 missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 45772710 critical splice donor site probably null
R4033:Sorbs2 UTSW 8 45775595 missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 45795293 missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 45741615 intron probably benign
R4926:Sorbs2 UTSW 8 45796217 missense probably benign 0.03
R5027:Sorbs2 UTSW 8 45746534 intron probably null
R5118:Sorbs2 UTSW 8 45795785 missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R5342:Sorbs2 UTSW 8 45796013 missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 45819741 missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 45796001 missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 45741581 critical splice donor site probably null
R5687:Sorbs2 UTSW 8 45775632 missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 45792875 missense probably benign 0.27
R5733:Sorbs2 UTSW 8 45759189 missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 45763183 missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 45769897 critical splice donor site probably null
R6341:Sorbs2 UTSW 8 45770578 missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 45796176 missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 45772614 missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 45795823 nonsense probably null
R7524:Sorbs2 UTSW 8 45795656 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTAATACCTGCTGCTGAACGAG -3'
(R):5'- TGCACAGAGCTATGCACAATCCATC -3'

Sequencing Primer
(F):5'- TGCTGCTGAACGAGACAGAG -3'
(R):5'- GAGCTATGCACAATCCATCCTTTG -3'
Posted On2014-05-23