Incidental Mutation 'R1759:Slc18a1'
ID195188
Institutional Source Beutler Lab
Gene Symbol Slc18a1
Ensembl Gene ENSMUSG00000036330
Gene Namesolute carrier family 18 (vesicular monoamine), member 1
Synonyms4832416I10Rik
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69037711-69089235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69065585 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 259 (I259T)
Ref Sequence ENSEMBL: ENSMUSP00000046924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037478
AA Change: I259T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046924
Gene: ENSMUSG00000036330
AA Change: I259T

DomainStartEndE-ValueType
Pfam:MFS_1 24 430 3.7e-34 PFAM
Pfam:MFS_1 302 508 9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162457
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into vesicles, using the proton gradient maintained across the vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (Peter et al., 1993 [PubMed 7905859]). See also SLC18A2 (MIM 193001).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased neuron apoptosis, decreased neuron proliferation and impaired spatial object recognition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Slc18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc18a1 APN 8 69051346 missense probably damaging 1.00
IGL00661:Slc18a1 APN 8 69073731 missense probably benign 0.00
IGL01568:Slc18a1 APN 8 69065626 missense probably damaging 1.00
IGL02199:Slc18a1 APN 8 69043980 missense probably benign 0.03
IGL03011:Slc18a1 APN 8 69038863 missense probably benign
IGL03260:Slc18a1 APN 8 69075114 missense probably benign 0.24
R0349:Slc18a1 UTSW 8 69072101 missense probably damaging 1.00
R1019:Slc18a1 UTSW 8 69075033 critical splice donor site probably null
R1928:Slc18a1 UTSW 8 69073812 missense probably benign 0.00
R2058:Slc18a1 UTSW 8 69043961 missense probably damaging 1.00
R4652:Slc18a1 UTSW 8 69043931 missense possibly damaging 0.71
R4724:Slc18a1 UTSW 8 69073649 nonsense probably null
R4818:Slc18a1 UTSW 8 69040299 missense probably damaging 0.99
R6799:Slc18a1 UTSW 8 69040981 missense probably benign 0.05
R6989:Slc18a1 UTSW 8 69038862 missense probably benign 0.01
R7557:Slc18a1 UTSW 8 69065561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACCCTAAGTGTAAGCCTGCC -3'
(R):5'- TCAGTAGAGCTTAGTCCCCAAAGCC -3'

Sequencing Primer
(F):5'- CCTGCCTGGAATCTAAATCTGGAG -3'
(R):5'- ttagtccccaaagccttcag -3'
Posted On2014-05-23