Incidental Mutation 'R1759:Gsdma3'
ID195219
Institutional Source Beutler Lab
Gene Symbol Gsdma3
Ensembl Gene ENSMUSG00000064224
Gene Namegasdermin A3
SynonymsGsdm1l, Bsk, Rim3, Dfl, Rco2, Gsdm3, Fgn
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98626360-98638226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98635245 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000103132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073295] [ENSMUST00000107508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073295
AA Change: V274A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073022
Gene: ENSMUSG00000064224
AA Change: V274A

DomainStartEndE-ValueType
Pfam:Gasdermin 3 430 1.4e-132 PFAM
low complexity region 438 452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107508
AA Change: V265A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103132
Gene: ENSMUSG00000064224
AA Change: V265A

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 9.5e-134 PFAM
low complexity region 429 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Gsdma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Gsdma3 APN 11 98637572 missense probably damaging 0.97
IGL01375:Gsdma3 APN 11 98629941 critical splice donor site probably null
IGL01721:Gsdma3 APN 11 98637956 missense possibly damaging 0.95
IGL02179:Gsdma3 APN 11 98635271 missense possibly damaging 0.88
IGL02612:Gsdma3 APN 11 98635881 missense probably damaging 0.99
IGL02866:Gsdma3 APN 11 98629759 missense possibly damaging 0.88
IGL02970:Gsdma3 APN 11 98632993 missense probably benign 0.01
Michelin UTSW 11 98637573 missense probably damaging 0.98
Mr_magoo UTSW 11 98635919 missense probably damaging 1.00
PIT4486001:Gsdma3 UTSW 11 98638054 missense unknown
R0408:Gsdma3 UTSW 11 98635338 missense probably benign 0.41
R0539:Gsdma3 UTSW 11 98635919 missense probably damaging 1.00
R0675:Gsdma3 UTSW 11 98631191 missense probably benign 0.03
R1329:Gsdma3 UTSW 11 98632392 missense probably damaging 1.00
R1812:Gsdma3 UTSW 11 98632393 missense probably damaging 0.99
R1838:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R1839:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R2287:Gsdma3 UTSW 11 98638004 missense possibly damaging 0.83
R4883:Gsdma3 UTSW 11 98629567 critical splice donor site probably null
R6767:Gsdma3 UTSW 11 98637884 missense possibly damaging 0.93
R7053:Gsdma3 UTSW 11 98629795 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CACCCCTTGGGAAAGAGGAAAAGTC -3'
(R):5'- ACCTAGCACTTGGCACACAGTAATC -3'

Sequencing Primer
(F):5'- TCAGATAAAAGCTGGAATCAGGGC -3'
(R):5'- TACAAGCTGTTATCCAGCAGG -3'
Posted On2014-05-23