Incidental Mutation 'R1759:Abca5'
ID195221
Institutional Source Beutler Lab
Gene Symbol Abca5
Ensembl Gene ENSMUSG00000018800
Gene NameATP-binding cassette, sub-family A (ABC1), member 5
SynonymsABC13, B930033A02Rik
MMRRC Submission 039791-MU
Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110269369-110337716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110293848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 944 (D944G)
Ref Sequence ENSEMBL: ENSMUSP00000120708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]
Predicted Effect probably benign
Transcript: ENSMUST00000043961
AA Change: D944G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: D944G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 29 416 4.3e-33 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
low complexity region 1262 1267 N/A INTRINSIC
AAA 1325 1512 3.52e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124714
AA Change: D944G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: D944G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 30 416 9.5e-32 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1019 1041 N/A INTRINSIC
transmembrane domain 1074 1096 N/A INTRINSIC
transmembrane domain 1103 1125 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
transmembrane domain 1165 1187 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Mak C A 13: 41,056,634 W42L probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Abca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Abca5 APN 11 110309450 critical splice acceptor site probably null
IGL00675:Abca5 APN 11 110304985 missense probably damaging 1.00
IGL01512:Abca5 APN 11 110317823 missense probably benign 0.40
IGL01559:Abca5 APN 11 110272526 missense probably benign
IGL01584:Abca5 APN 11 110304923 missense probably damaging 0.98
IGL01604:Abca5 APN 11 110277636 missense possibly damaging 0.47
IGL01828:Abca5 APN 11 110287695 missense probably benign
IGL01880:Abca5 APN 11 110293263 missense probably benign 0.01
IGL02054:Abca5 APN 11 110292123 missense probably damaging 0.99
IGL02074:Abca5 APN 11 110293350 missense probably benign 0.00
IGL02233:Abca5 APN 11 110274344 nonsense probably null
IGL02245:Abca5 APN 11 110298169 nonsense probably null
IGL02317:Abca5 APN 11 110327761 missense probably benign 0.09
IGL02352:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02359:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02390:Abca5 APN 11 110296551 missense probably benign
IGL02600:Abca5 APN 11 110309438 missense probably benign 0.02
IGL02639:Abca5 APN 11 110288073 missense possibly damaging 0.79
IGL03000:Abca5 APN 11 110317814 missense probably benign 0.04
IGL03074:Abca5 APN 11 110310275 missense probably benign 0.01
IGL03078:Abca5 APN 11 110276545 nonsense probably null
IGL03342:Abca5 APN 11 110287691 missense possibly damaging 0.94
IGL03368:Abca5 APN 11 110313522 splice site probably benign
atles UTSW 11 110299929 missense probably damaging 0.99
demento UTSW 11 110310233 missense probably damaging 1.00
jones UTSW 11 110288058 splice site probably null
R0106:Abca5 UTSW 11 110319825 missense probably damaging 1.00
R0116:Abca5 UTSW 11 110276505 missense probably damaging 1.00
R0305:Abca5 UTSW 11 110273311 splice site probably benign
R0550:Abca5 UTSW 11 110293840 missense probably damaging 1.00
R0578:Abca5 UTSW 11 110276489 nonsense probably null
R0587:Abca5 UTSW 11 110311377 missense probably benign 0.00
R0610:Abca5 UTSW 11 110301527 missense probably benign 0.00
R0617:Abca5 UTSW 11 110279689 missense probably damaging 0.98
R0667:Abca5 UTSW 11 110327811 missense probably benign 0.00
R0844:Abca5 UTSW 11 110319832 missense probably benign 0.00
R1273:Abca5 UTSW 11 110326665 missense probably benign 0.01
R1463:Abca5 UTSW 11 110314558 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299978 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299986 missense possibly damaging 0.73
R1687:Abca5 UTSW 11 110293888 missense probably benign 0.32
R1870:Abca5 UTSW 11 110329217 missense probably benign 0.33
R2006:Abca5 UTSW 11 110313449 missense probably benign
R2039:Abca5 UTSW 11 110299929 missense probably damaging 0.99
R2076:Abca5 UTSW 11 110287652 missense probably benign 0.10
R2136:Abca5 UTSW 11 110319832 missense probably benign 0.00
R2154:Abca5 UTSW 11 110292174 missense probably benign 0.00
R2273:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2274:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2275:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2328:Abca5 UTSW 11 110276521 missense probably damaging 0.99
R3702:Abca5 UTSW 11 110288058 splice site probably null
R3768:Abca5 UTSW 11 110313391 missense probably benign 0.01
R3872:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3873:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3874:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3875:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R4347:Abca5 UTSW 11 110299968 missense probably damaging 1.00
R4429:Abca5 UTSW 11 110311410 missense probably benign 0.00
R4790:Abca5 UTSW 11 110311410 missense possibly damaging 0.63
R4812:Abca5 UTSW 11 110301821 missense probably damaging 1.00
R4833:Abca5 UTSW 11 110279316 missense probably benign 0.00
R4883:Abca5 UTSW 11 110326631 missense probably damaging 1.00
R5000:Abca5 UTSW 11 110310224 missense probably damaging 1.00
R5004:Abca5 UTSW 11 110279376 missense probably damaging 0.99
R5066:Abca5 UTSW 11 110309350 intron probably benign
R5230:Abca5 UTSW 11 110319860 missense probably benign
R5321:Abca5 UTSW 11 110327825 missense probably benign
R5350:Abca5 UTSW 11 110319796 nonsense probably null
R5414:Abca5 UTSW 11 110314622 missense probably damaging 1.00
R5437:Abca5 UTSW 11 110319796 nonsense probably null
R5451:Abca5 UTSW 11 110319796 nonsense probably null
R5453:Abca5 UTSW 11 110319796 nonsense probably null
R5488:Abca5 UTSW 11 110292183 missense probably benign 0.00
R5636:Abca5 UTSW 11 110301536 missense probably benign 0.00
R5805:Abca5 UTSW 11 110279390 missense probably benign 0.06
R5900:Abca5 UTSW 11 110279156 missense possibly damaging 0.92
R6152:Abca5 UTSW 11 110313361 missense probably damaging 1.00
R6167:Abca5 UTSW 11 110292105 missense probably benign 0.10
R6343:Abca5 UTSW 11 110314552 missense probably damaging 1.00
R6425:Abca5 UTSW 11 110329232 missense possibly damaging 0.75
R6493:Abca5 UTSW 11 110293878 missense probably benign 0.00
R6498:Abca5 UTSW 11 110292102 missense possibly damaging 0.70
R6884:Abca5 UTSW 11 110329217 missense probably damaging 0.96
R6912:Abca5 UTSW 11 110306280 missense probably benign 0.35
R7084:Abca5 UTSW 11 110301545 missense probably benign 0.22
R7239:Abca5 UTSW 11 110326704 missense possibly damaging 0.94
R7490:Abca5 UTSW 11 110277611 missense possibly damaging 0.95
R7527:Abca5 UTSW 11 110327730 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAATGGGATAGGTTCAGCCAACTGAC -3'
(R):5'- GAGCAGGACCTCTCTACTCATCAGAC -3'

Sequencing Primer
(F):5'- TTCAGCCAACTGACCTCAGAG -3'
(R):5'- ggcagaggagcaaactaagac -3'
Posted On2014-05-23