Incidental Mutation 'R1759:Mak'
ID195225
Institutional Source Beutler Lab
Gene Symbol Mak
Ensembl Gene ENSMUSG00000021363
Gene Namemale germ cell-associated kinase
SynonymsA930010O05Rik
MMRRC Submission 039791-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R1759 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location41025008-41079706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41056634 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 42 (W42L)
Ref Sequence ENSEMBL: ENSMUSP00000152946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021792] [ENSMUST00000070193] [ENSMUST00000165087] [ENSMUST00000224423] [ENSMUST00000224740] [ENSMUST00000225084]
Predicted Effect probably damaging
Transcript: ENSMUST00000021792
AA Change: W42L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021792
Gene: ENSMUSG00000021363
AA Change: W42L

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070193
AA Change: W42L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064750
Gene: ENSMUSG00000021363
AA Change: W42L

DomainStartEndE-ValueType
S_TKc 4 253 3.81e-70 SMART
low complexity region 325 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165087
AA Change: W42L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129615
Gene: ENSMUSG00000021363
AA Change: W42L

DomainStartEndE-ValueType
S_TKc 4 284 5.24e-100 SMART
low complexity region 356 369 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224423
AA Change: W42L

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000224740
AA Change: W42L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225084
AA Change: W42L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225789
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. Mutations in this gene have been associated with ciliary defects resulting in retinitis pigmentosa 62. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit slight reductions in litter size and sperm motility in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,625,710 I369N probably benign Het
4931428F04Rik A T 8: 105,285,550 S88R probably damaging Het
9330159F19Rik A T 10: 29,218,276 M53L possibly damaging Het
Abca5 T C 11: 110,293,848 D944G probably benign Het
Ankdd1b T C 13: 96,419,703 Y433C probably damaging Het
Aox3 A G 1: 58,170,646 probably null Het
Ap1g1 G A 8: 109,833,221 G260E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a4 T A 16: 29,456,611 T352S probably damaging Het
Ccdc33 T A 9: 58,117,446 N166Y possibly damaging Het
Ces2h T A 8: 105,016,611 D159E probably damaging Het
Chd1 T A 17: 17,387,271 D360E probably benign Het
Col16a1 G T 4: 130,084,269 G781V probably damaging Het
Col6a5 T A 9: 105,930,846 E1001V unknown Het
Cyp3a59 T G 5: 146,098,250 M246R probably benign Het
Dcn T C 10: 97,513,655 V263A probably benign Het
Dnttip2 A G 3: 122,276,149 N338D probably benign Het
Entpd1 G T 19: 40,612,524 probably null Het
Epb41l1 A G 2: 156,521,974 D801G probably benign Het
Fam186a T A 15: 99,966,881 K23* probably null Het
Gbe1 T C 16: 70,488,041 M417T probably benign Het
Gmnc T A 16: 26,965,747 S3C possibly damaging Het
Gpr156 T C 16: 37,948,221 S35P probably damaging Het
Grid1 T C 14: 35,446,031 M504T possibly damaging Het
Gsdma3 T C 11: 98,635,245 V265A possibly damaging Het
Hsd3b3 A T 3: 98,742,083 I308N probably damaging Het
Inpp4b A G 8: 81,768,103 D49G probably benign Het
Ipmk C A 10: 71,381,303 Q227K probably damaging Het
Kalrn T A 16: 34,360,950 D88V probably damaging Het
Kansl1l C T 1: 66,801,888 M84I probably damaging Het
Kcnab2 T G 4: 152,393,052 K363Q probably damaging Het
Kdm7a C A 6: 39,147,699 probably null Het
Kiss1r T C 10: 79,921,778 L322P probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lrpprc T C 17: 84,740,081 K908E probably damaging Het
Map3k21 A G 8: 125,944,780 T936A probably benign Het
March7 C T 2: 60,234,544 S388F probably damaging Het
Mgat2 A T 12: 69,185,527 I292F probably benign Het
Myh3 C A 11: 67,096,891 R1397S probably damaging Het
Myo5a A G 9: 75,181,993 D1135G possibly damaging Het
N4bp2 A G 5: 65,826,613 E1667G probably damaging Het
Nbr1 A G 11: 101,559,543 T43A probably damaging Het
Nip7 A G 8: 107,058,135 N124S probably benign Het
Olfr410 G A 11: 74,334,982 S83F possibly damaging Het
Olfr606 T C 7: 103,452,149 S271P probably benign Het
Olfr790 T A 10: 129,500,906 S7R probably benign Het
Olfr843 C T 9: 19,249,088 V104I probably benign Het
Olfr922 T C 9: 38,815,898 Y132H probably damaging Het
Otoa T C 7: 121,134,103 L731P probably damaging Het
Pcnx2 G A 8: 125,773,978 P1458S probably damaging Het
Pfpl A G 19: 12,429,860 T492A probably damaging Het
Pgm2 A G 4: 99,967,108 D326G probably damaging Het
Plekhh1 T A 12: 79,072,761 Y953N probably damaging Het
Pnkd G A 1: 74,348,763 A195T probably damaging Het
Ppib C T 9: 66,061,482 Q51* probably null Het
Ppip5k1 G T 2: 121,350,586 T13K probably benign Het
Psmg2 A T 18: 67,648,176 S113C probably benign Het
Rapgef2 A G 3: 79,066,731 M1584T possibly damaging Het
Rbm12b1 A C 4: 12,145,424 R465S probably damaging Het
Reln A G 5: 22,010,289 Y1055H probably damaging Het
Ros1 A T 10: 52,120,826 I1250K probably damaging Het
Samd9l C A 6: 3,373,401 V1287F probably damaging Het
Sgce A T 6: 4,689,765 I356N probably damaging Het
Sh3tc1 C T 5: 35,705,904 E980K possibly damaging Het
Sil1 T C 18: 35,418,098 E68G possibly damaging Het
Slc18a1 A G 8: 69,065,585 I259T possibly damaging Het
Slc6a20b A C 9: 123,608,997 probably null Het
Smg7 G T 1: 152,848,846 T536K probably benign Het
Smyd4 A G 11: 75,382,366 Y84C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Sorbs2 A T 8: 45,763,019 *50C probably null Het
Speg A T 1: 75,401,162 M855L possibly damaging Het
Srrt G T 5: 137,302,950 H71Q probably damaging Het
St6galnac5 A G 3: 152,846,493 S146P probably damaging Het
Syne1 T A 10: 5,349,369 Q962L probably damaging Het
Tiam2 A G 17: 3,516,003 H1441R probably damaging Het
Tmem45a C T 16: 56,822,402 M135I probably benign Het
Tpr A T 1: 150,429,524 E1521D probably benign Het
Uba3 C T 6: 97,196,904 G107R probably damaging Het
Unc45b G T 11: 82,929,499 V590F probably benign Het
Vmn1r14 A T 6: 57,234,312 T292S probably benign Het
Vmn2r102 T A 17: 19,694,493 N773K probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wfs1 G C 5: 36,967,015 A844G probably damaging Het
Zfp398 A G 6: 47,859,478 T71A possibly damaging Het
Zfp507 C A 7: 35,775,978 A145S probably damaging Het
Zfp971 A T 2: 178,033,929 E440D probably damaging Het
Other mutations in Mak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Mak APN 13 41055689 splice site probably benign
IGL00543:Mak APN 13 41055713 missense probably damaging 1.00
IGL00772:Mak APN 13 41055820 splice site probably benign
IGL01113:Mak APN 13 41042143 missense probably damaging 1.00
IGL01363:Mak APN 13 41053377 splice site probably benign
IGL01673:Mak APN 13 41048223 splice site probably null
IGL01872:Mak APN 13 41056655 missense probably damaging 1.00
IGL02051:Mak APN 13 41042082 missense probably benign 0.00
R0126:Mak UTSW 13 41032596 missense probably damaging 1.00
R0377:Mak UTSW 13 41049348 missense probably damaging 1.00
R0511:Mak UTSW 13 41046267 missense probably benign
R0557:Mak UTSW 13 41039659 missense probably benign 0.11
R0616:Mak UTSW 13 41042185 missense probably benign 0.05
R0786:Mak UTSW 13 41046069 missense probably benign 0.00
R0855:Mak UTSW 13 41070164 missense probably damaging 1.00
R1430:Mak UTSW 13 41070284 start gained probably benign
R1603:Mak UTSW 13 41042106 missense possibly damaging 0.69
R2042:Mak UTSW 13 41049436 missense possibly damaging 0.60
R2148:Mak UTSW 13 41042037 missense probably benign 0.01
R2155:Mak UTSW 13 41032544 missense probably benign 0.00
R4124:Mak UTSW 13 41056630 missense probably benign 0.00
R5040:Mak UTSW 13 41030098 missense possibly damaging 0.61
R5141:Mak UTSW 13 41032563 missense possibly damaging 0.94
R6167:Mak UTSW 13 41053352 missense probably benign 0.07
R6937:Mak UTSW 13 41048102 missense probably damaging 1.00
R6964:Mak UTSW 13 41032591 missense probably benign 0.00
R7201:Mak UTSW 13 41051440 missense possibly damaging 0.94
R7474:Mak UTSW 13 41051480 missense probably damaging 1.00
X0024:Mak UTSW 13 41051369 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAACACAGGAGTGAGGGCTTCAG -3'
(R):5'- TCATGATGGTGTCGAAGCAGGATG -3'

Sequencing Primer
(F):5'- tcacaacagtagcaaaatgacag -3'
(R):5'- ATGGTGGGCCAGACCTG -3'
Posted On2014-05-23