Incidental Mutation 'R1781:Cdh8'
ID195291
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
Synonymscad8
MMRRC Submission 039812-MU
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1781 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 99190462 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000145601] [ENSMUST00000155527]
Predicted Effect probably null
Transcript: ENSMUST00000093249
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126895
Predicted Effect probably null
Transcript: ENSMUST00000128860
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142129
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145601
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000155527
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.1%
Validation Efficiency 97% (88/91)
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik C T 8: 3,380,495 R123W probably damaging Het
Aadacl2 A G 3: 60,024,696 K211E probably damaging Het
Abca13 T A 11: 9,269,194 L376Q probably damaging Het
Abca17 T C 17: 24,267,557 T1499A possibly damaging Het
Anks6 A C 4: 47,043,639 N363K possibly damaging Het
Apob T A 12: 8,009,603 I2695N possibly damaging Het
Atg14 T A 14: 47,549,150 probably null Het
Atg2a A T 19: 6,256,213 I1368F probably damaging Het
Btbd9 A G 17: 30,513,593 S373P probably damaging Het
Ccdc83 T C 7: 90,250,541 E41G probably damaging Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdr2 G A 7: 120,958,045 P419L probably benign Het
Cds1 T A 5: 101,812,550 I289K possibly damaging Het
Cherp G A 8: 72,467,771 T394I probably damaging Het
Cyp4f17 T G 17: 32,524,019 I222S possibly damaging Het
Dcc A G 18: 71,378,717 S856P probably benign Het
Dcp1a C T 14: 30,513,075 T221I probably benign Het
Ddx10 A G 9: 53,207,545 S475P probably damaging Het
Dennd5b G T 6: 149,027,398 A759E probably damaging Het
Disp2 G A 2: 118,792,561 G1258D probably damaging Het
Fam208b T C 13: 3,584,759 T683A possibly damaging Het
Fhdc1 A T 3: 84,448,804 D444E probably damaging Het
Fhod1 T C 8: 105,347,789 probably benign Het
Gcnt7 T C 2: 172,454,880 K8R probably benign Het
Gk5 C T 9: 96,133,455 T108I possibly damaging Het
Gm8214 C A 1: 183,681,932 noncoding transcript Het
Gnl1 A T 17: 35,987,746 I434F probably damaging Het
Golga2 T C 2: 32,306,576 Y986H probably damaging Het
Gpr21 T C 2: 37,517,538 V32A probably benign Het
Grb14 A T 2: 64,975,555 probably null Het
H6pd A T 4: 149,995,931 F144L probably damaging Het
Hunk A G 16: 90,432,560 Y27C probably damaging Het
Ints7 C T 1: 191,596,284 T223M possibly damaging Het
Kcnmb2 T C 3: 32,179,003 probably null Het
Lilra6 A T 7: 3,915,067 L26H probably benign Het
Mc4r A T 18: 66,859,847 V65E probably damaging Het
Mgam G A 6: 40,669,863 G708R probably damaging Het
Mllt6 A G 11: 97,672,569 D326G probably benign Het
Myo7a A T 7: 98,073,124 V1198D probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Nlrp4b G C 7: 10,715,339 V123L probably benign Het
Ntpcr T A 8: 125,745,402 L150Q probably damaging Het
Obscn C T 11: 59,106,337 E1513K probably damaging Het
Ola1 T C 2: 73,156,755 K178E possibly damaging Het
Olfr1351 T C 10: 79,017,325 M1T probably null Het
Olfr1364 C T 13: 21,573,541 G305D probably damaging Het
Olfr1368 C T 13: 21,142,764 V98I probably benign Het
Olfr139 A T 11: 74,044,960 F105I probably damaging Het
Olfr486 A G 7: 108,171,883 V287A probably benign Het
Olfr53 A T 7: 140,652,506 I176F probably damaging Het
Olfr615 C T 7: 103,560,566 P30S probably benign Het
Olfr629 T C 7: 103,740,821 M140V probably benign Het
Olfr672 A T 7: 104,996,108 F265L possibly damaging Het
Olfr981 A G 9: 40,023,245 N284S probably damaging Het
Opalin T C 19: 41,067,631 probably null Het
P2ry12 A G 3: 59,217,778 F159L probably benign Het
Paqr7 T C 4: 134,507,281 probably null Het
Parp1 T C 1: 180,588,013 S466P probably benign Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh1 T C 18: 38,189,924 D952G probably damaging Het
Pde6c T C 19: 38,151,698 S336P possibly damaging Het
Pgk2 T C 17: 40,208,507 D10G probably benign Het
Phf20l1 A G 15: 66,632,825 T771A probably damaging Het
Pkdrej A G 15: 85,821,171 V188A possibly damaging Het
Plekhm1 A G 11: 103,394,856 L251P probably damaging Het
Prex2 A T 1: 11,199,955 N1288I probably benign Het
Sarnp T C 10: 128,833,322 L16P probably damaging Het
Scgb3a2 T C 18: 43,766,968 probably benign Het
Scn11a A T 9: 119,755,082 I1489N probably damaging Het
Scn3a A T 2: 65,472,385 L1239Q probably damaging Het
Shisa9 T C 16: 12,267,657 S377P probably benign Het
Slc22a30 T A 19: 8,335,772 T550S probably damaging Het
Slc25a11 T C 11: 70,644,825 T296A probably benign Het
Slc35f1 T A 10: 53,062,436 probably null Het
Slc6a13 A G 6: 121,334,852 E396G probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srsf9 C A 5: 115,327,422 Y9* probably null Het
Tbx20 T C 9: 24,725,499 I431V probably benign Het
Tespa1 G A 10: 130,348,250 G67S probably benign Het
Trhde A T 10: 114,588,500 V460E possibly damaging Het
Trip12 A T 1: 84,730,621 F1739I probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 G A 17: 30,968,550 R196H probably damaging Het
Vezf1 G T 11: 88,081,621 M269I probably benign Het
Vmn1r35 A T 6: 66,679,566 M40K probably benign Het
Vmn1r9 G T 6: 57,071,315 C125F probably benign Het
Vmn2r12 C A 5: 109,091,728 G323V probably benign Het
Vmn2r79 A T 7: 87,002,347 H318L probably benign Het
Zfhx3 T A 8: 108,793,535 S430T probably benign Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1717:Cdh8 UTSW 8 99030705 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4666:Cdh8 UTSW 8 99024902 missense possibly damaging 0.71
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R5686:Cdh8 UTSW 8 99033222 missense probably benign 0.00
R6311:Cdh8 UTSW 8 99400895 missense probably damaging 0.99
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAATGAAGCACCGTGTACAACAG -3'
(R):5'- TCTGCCACCAGCAGAAAGCTTG -3'

Sequencing Primer
(F):5'- ATATCAGGGTCACGAGCTGTC -3'
(R):5'- CGCTGAAGTGAGAATTTGATGCTAC -3'
Posted On2014-05-23