Incidental Mutation 'R0078:Olfr215'
ID19538
Institutional Source Beutler Lab
Gene Symbol Olfr215
Ensembl Gene ENSMUSG00000050654
Gene Nameolfactory receptor 215
SynonymsMOR119-2, GA_x54KRFPKN04-58217732-58216800
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116580084-116584195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116582740 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 69 (S69P)
Ref Sequence ENSEMBL: ENSMUSP00000052425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061723]
Predicted Effect probably damaging
Transcript: ENSMUST00000061723
AA Change: S69P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052425
Gene: ENSMUSG00000050654
AA Change: S69P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 258 1.8e-5 PFAM
Pfam:7tm_1 39 288 2.9e-15 PFAM
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Olfr215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Olfr215 APN 6 116582335 missense possibly damaging 0.93
IGL02959:Olfr215 APN 6 116582544 missense probably damaging 1.00
IGL03053:Olfr215 APN 6 116582245 missense possibly damaging 0.50
R0277:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0323:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0399:Olfr215 UTSW 6 116582781 missense probably benign 0.00
R0545:Olfr215 UTSW 6 116582656 missense probably benign 0.01
R1213:Olfr215 UTSW 6 116582866 missense probably benign 0.00
R1775:Olfr215 UTSW 6 116582964 start gained probably benign
R1789:Olfr215 UTSW 6 116582697 missense probably damaging 1.00
R4724:Olfr215 UTSW 6 116582937 missense probably damaging 1.00
R5391:Olfr215 UTSW 6 116582847 missense probably damaging 1.00
R5392:Olfr215 UTSW 6 116582418 missense probably damaging 1.00
R5686:Olfr215 UTSW 6 116582929 missense probably benign 0.00
R6124:Olfr215 UTSW 6 116582485 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCAGAGGCTTGCAAATAGCTACAC -3'
(R):5'- ACCTTGAACAGGCTGCTGAATGAC -3'

Sequencing Primer
(F):5'- TTGCAAATAGCTACACACCTGTC -3'
(R):5'- TGCACTGTGAGAATACCTCTG -3'
Posted On2013-04-11