Incidental Mutation 'R1782:Flii'
ID195415
Institutional Source Beutler Lab
Gene Symbol Flii
Ensembl Gene ENSMUSG00000002812
Gene Nameflightless I actin binding protein
SynonymsFliih, 3632430F08Rik
MMRRC Submission 039813-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1782 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60714123-60727263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60714636 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1212 (T1212A)
Ref Sequence ENSEMBL: ENSMUSP00000002889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably benign
Transcript: ENSMUST00000002889
AA Change: T1212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812
AA Change: T1212A

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154465
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with gelsolin-like repeats and an N-terminal leucine-rich repeat domain. The protein is similar to a Drosophila protein involved in early embryogenesis and the structural organization of indirect flight muscle. This protein may act as an actin-remodelling protein as well as a transcriptional coactivator. Homozygous knockout mice show embryonic lethality. This protein may act to regulate wound repair. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are able to initiate uterine implantation but degenerate rapidly thereafter. Heterozygous mutant mice display enhanced wound healing with increased epithelial migration and improved wound contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,688 I47V probably benign Het
9330182L06Rik A T 5: 9,421,620 K320N possibly damaging Het
Abca13 A T 11: 9,297,971 T2573S probably benign Het
Adgra3 G T 5: 49,972,062 T738K probably benign Het
Adgrl4 C T 3: 151,542,805 Q705* probably null Het
Atp2b1 T G 10: 99,003,201 D630E probably benign Het
Atp2c1 G A 9: 105,431,587 R577C probably damaging Het
Atp9b A G 18: 80,765,922 V211A probably damaging Het
C8g T A 2: 25,499,082 D163V possibly damaging Het
Catsper1 T C 19: 5,335,909 Y57H probably benign Het
Ccdc25 C T 14: 65,854,148 A72V probably benign Het
Cdca2 T G 14: 67,677,811 E666D probably benign Het
Cdh23 G A 10: 60,488,542 T313I probably damaging Het
Cfap57 C A 4: 118,614,975 R69L probably damaging Het
Chat C A 14: 32,408,987 V566L probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Cog1 A G 11: 113,653,966 T325A probably benign Het
Cxcl10 A G 5: 92,347,803 *94Q probably null Het
Cyp4a12b T C 4: 115,433,981 Y369H probably damaging Het
Dhx33 T C 11: 71,001,640 Y101C probably damaging Het
Dock6 A G 9: 21,811,846 M1593T probably damaging Het
Dpy19l3 T C 7: 35,708,155 T488A possibly damaging Het
Fam198b T C 3: 79,886,531 L102S possibly damaging Het
Fbxw14 A G 9: 109,278,691 I205T possibly damaging Het
Fbxw7 T C 3: 84,903,819 F84L probably benign Het
Fosl1 T A 19: 5,450,182 I43N probably damaging Het
Gabrr2 G A 4: 33,085,593 A338T probably damaging Het
Gatad2b T C 3: 90,341,871 V72A probably benign Het
Gorasp1 G T 9: 119,932,822 N48K probably damaging Het
Gramd1b C A 9: 40,413,337 D139Y probably damaging Het
Gtf3c1 A T 7: 125,667,074 V1030E probably damaging Het
H2afy A T 13: 56,074,321 M339K probably damaging Het
Havcr2 C T 11: 46,455,017 T6I unknown Het
Hgs A G 11: 120,478,505 E340G probably damaging Het
Irx2 A G 13: 72,631,466 T290A probably benign Het
Itgb8 T A 12: 119,192,118 I200F probably damaging Het
Josd2 A G 7: 44,471,153 I105V probably damaging Het
Kcnh7 T A 2: 62,736,169 D806V probably damaging Het
Kctd8 A G 5: 69,340,976 V109A possibly damaging Het
Kmt2d T A 15: 98,857,548 probably benign Het
Krtap2-4 A T 11: 99,614,527 V86E probably damaging Het
Lgr6 C G 1: 134,987,979 V344L probably damaging Het
Lime1 A T 2: 181,383,056 R168W possibly damaging Het
Magel2 C T 7: 62,380,857 Q1170* probably null Het
Ndufaf3 A T 9: 108,566,011 I169N probably damaging Het
Neb T A 2: 52,284,345 K1501* probably null Het
Nim1k A T 13: 119,712,151 S402R probably benign Het
Nt5dc2 T G 14: 31,138,201 S395R probably damaging Het
Oaz2 G T 9: 65,688,861 V132L probably benign Het
Olfr1089 T C 2: 86,732,682 K310R probably benign Het
Olfr1457 T A 19: 13,094,803 I282F probably damaging Het
Olfr315 T A 11: 58,778,805 L226H probably damaging Het
Olfr723 A T 14: 49,928,639 W302R probably benign Het
Olfr843 C T 9: 19,248,581 V273I probably benign Het
Pfkl A G 10: 77,988,720 V717A probably benign Het
Phgdh C T 3: 98,320,747 V231I probably damaging Het
Pkhd1 A T 1: 20,565,711 M465K probably damaging Het
Ppp3r1 A G 11: 17,198,281 H163R probably benign Het
Prune2 T A 19: 17,122,173 N1680K probably benign Het
Puf60 T A 15: 76,071,875 I216L probably benign Het
Rev3l T A 10: 39,799,885 N190K probably benign Het
Rp1 G A 1: 4,349,089 S600L probably benign Het
Rpl3l A G 17: 24,733,456 I217V probably benign Het
Scly T A 1: 91,308,380 V194D probably damaging Het
Scnn1b A G 7: 121,917,961 T607A probably benign Het
Slc13a3 G A 2: 165,445,519 L172F probably benign Het
Sorbs2 A G 8: 45,805,696 Y1090C probably damaging Het
Spag17 T A 3: 100,010,754 M351K probably benign Het
St14 A G 9: 31,100,164 Y444H probably damaging Het
Taf8 C A 17: 47,498,211 A109S probably benign Het
Tbc1d30 T A 10: 121,267,620 K502N probably damaging Het
Them5 T C 3: 94,344,489 S136P probably benign Het
Tmem248 T A 5: 130,231,928 N111K probably damaging Het
Tmem74 C A 15: 43,866,952 V232L probably damaging Het
Tnip2 A T 5: 34,499,668 H264Q probably benign Het
Trim5 A G 7: 104,265,816 probably null Het
Trim63 A G 4: 134,323,038 Q211R probably benign Het
Trrap T C 5: 144,822,703 V2231A possibly damaging Het
Ttn T C 2: 76,735,487 S28174G probably benign Het
Ugt2b36 T C 5: 87,081,581 D341G possibly damaging Het
Uroc1 G A 6: 90,336,919 E63K probably damaging Het
Ush2a T C 1: 188,911,185 V4248A probably benign Het
Usp1 A G 4: 98,934,198 H583R probably damaging Het
Usp8 T A 2: 126,720,051 F55Y probably damaging Het
Vmn2r13 T A 5: 109,158,174 T513S probably benign Het
Wdr73 T C 7: 80,891,778 T339A probably damaging Het
Wnt2 T A 6: 18,008,640 N266I possibly damaging Het
Wwp2 AGAACT A 8: 107,506,399 probably null Het
Other mutations in Flii
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Flii APN 11 60723415 missense probably benign 0.03
IGL00331:Flii APN 11 60715833 missense probably benign 0.40
IGL01530:Flii APN 11 60720182 nonsense probably null
IGL01678:Flii APN 11 60716846 unclassified probably benign
IGL01938:Flii APN 11 60715116 missense probably damaging 1.00
IGL02211:Flii APN 11 60718298 unclassified probably benign
IGL02626:Flii APN 11 60719859 missense probably benign 0.37
IGL03038:Flii APN 11 60724832 missense probably benign 0.01
IGL03412:Flii APN 11 60722640 missense probably damaging 0.99
Dry_tortugas UTSW 11 60720757 nonsense probably null
R0135:Flii UTSW 11 60723378 missense probably damaging 0.99
R0350:Flii UTSW 11 60721857 missense probably damaging 1.00
R0355:Flii UTSW 11 60719680 splice site probably null
R0524:Flii UTSW 11 60720061 missense probably damaging 0.98
R0636:Flii UTSW 11 60715552 missense probably damaging 1.00
R0639:Flii UTSW 11 60722997 splice site probably null
R1515:Flii UTSW 11 60721606 critical splice acceptor site probably null
R1544:Flii UTSW 11 60719692 critical splice donor site probably null
R2922:Flii UTSW 11 60718916 missense probably damaging 1.00
R3691:Flii UTSW 11 60719757 missense probably benign 0.03
R3753:Flii UTSW 11 60715480 missense probably benign
R3875:Flii UTSW 11 60720492 missense probably benign
R3876:Flii UTSW 11 60719872 missense possibly damaging 0.85
R3924:Flii UTSW 11 60720076 missense probably damaging 1.00
R4621:Flii UTSW 11 60716111 missense possibly damaging 0.95
R4789:Flii UTSW 11 60715093 missense probably benign 0.33
R5153:Flii UTSW 11 60716686 missense possibly damaging 0.89
R5326:Flii UTSW 11 60718862 missense probably benign 0.30
R5340:Flii UTSW 11 60717268 missense probably damaging 0.99
R5364:Flii UTSW 11 60720128 missense probably benign 0.00
R5542:Flii UTSW 11 60718862 missense probably benign 0.30
R5592:Flii UTSW 11 60720399 missense probably benign 0.00
R5859:Flii UTSW 11 60716311 nonsense probably null
R5968:Flii UTSW 11 60720212 missense probably benign
R6009:Flii UTSW 11 60720757 nonsense probably null
R6287:Flii UTSW 11 60721597 missense probably damaging 1.00
R6368:Flii UTSW 11 60721136 missense probably damaging 1.00
R6997:Flii UTSW 11 60722325 missense probably benign 0.14
R7099:Flii UTSW 11 60720655 missense probably benign 0.05
X0025:Flii UTSW 11 60721708 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCATTACCTTTGCGGACCAGGC -3'
(R):5'- TGAGACATTCTCCCACCTCAGAGC -3'

Sequencing Primer
(F):5'- CTGGATGTATACCTGGTAAGAAAAAC -3'
(R):5'- ctggcctcgaactcagaaatc -3'
Posted On2014-05-23