Incidental Mutation 'R1783:Etnk2'
ID195540
Institutional Source Beutler Lab
Gene Symbol Etnk2
Ensembl Gene ENSMUSG00000070644
Gene Nameethanolamine kinase 2
Synonyms4933417N20Rik, Eki2
MMRRC Submission 039814-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1783 (G1)
Quality Score220
Status Not validated
Chromosome1
Chromosomal Location133363572-133380336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 133365587 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 89 (D89E)
Ref Sequence ENSEMBL: ENSMUSP00000114272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129213] [ENSMUST00000135222]
Predicted Effect probably benign
Transcript: ENSMUST00000129213
SMART Domains Protein: ENSMUSP00000122244
Gene: ENSMUSG00000070644

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 200 4.7e-64 PFAM
Pfam:APH 2 227 2.2e-21 PFAM
Pfam:EcKinase 58 211 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131450
Predicted Effect probably benign
Transcript: ENSMUST00000135222
AA Change: D89E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644
AA Change: D89E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156832
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of choline/ethanolamine kinase family which catalyzes the first step of phosphatidylethanolamine (PtdEtn) biosynthesis via the cytidine diphosphate (CDP) ethanolamine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutation of this gene results in maternal-specific intrauterine growth retardation resulting in reduced litter size and perinatal lethality due to extensive placental thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 220 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,231,089 T307S probably damaging Het
4930590J08Rik T C 6: 91,919,278 I369T possibly damaging Het
Abhd17a T A 10: 80,584,026 I115F probably benign Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb2 C T 4: 130,009,305 T566I possibly damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Bbs9 T C 9: 22,659,119 V587A possibly damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn8 T C 1: 182,598,822 S241P probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep350 A C 1: 155,928,865 L824R probably damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Chit1 A G 1: 134,149,394 R312G possibly damaging Het
Chit1 G T 1: 134,149,395 R312I probably benign Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dock10 T G 1: 80,574,180 Y659S probably benign Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dsg2 G A 18: 20,591,880 V448I probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Efnb2 G T 8: 8,623,237 T140K probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Eogt T C 6: 97,113,864 D438G probably damaging Het
Etnppl A G 3: 130,620,749 T98A probably damaging Het
Fam131b T G 6: 42,318,580 Q221P possibly damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fam90a1a A G 8: 21,963,463 N278S probably benign Het
Fbxo40 T A 16: 36,966,222 M662L probably damaging Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fmo9 A T 1: 166,673,648 F192L probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gatad2a G T 8: 69,909,936 H600N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Git2 T C 5: 114,739,124 E99G probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10961 T C 3: 107,632,994 probably benign Het
Gm13119 G T 4: 144,361,725 E30D probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gpsm3 G A 17: 34,590,754 R52H possibly damaging Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
Hdac5 A G 11: 102,200,516 F683L probably benign Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irx5 A C 8: 92,359,688 E133A probably damaging Het
Itgb5 C T 16: 33,940,562 T589I probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna5 A T 6: 126,533,860 I435N probably damaging Het
Kcnj5 T C 9: 32,322,192 I276V probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krt2 T C 15: 101,813,973 R426G probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lin7b A T 7: 45,369,927 H72Q probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Map3k9 A T 12: 81,722,226 V1016E probably damaging Het
Mcam T C 9: 44,134,706 L6P probably damaging Het
Mgam A G 6: 40,664,860 H549R possibly damaging Het
Miip G A 4: 147,865,774 P122S probably damaging Het
Mkrn1 T A 6: 39,400,456 N282Y probably null Het
Mrc1 T C 2: 14,327,844 V1285A probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myh7b A G 2: 155,625,672 D739G possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Nfkbib A T 7: 28,762,055 Y86N probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrip1 G T 16: 76,292,890 T593K probably benign Het
Obscn A G 11: 59,073,633 Y726H probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1307 T C 2: 111,945,288 H56R probably benign Het
Olfr924 T A 9: 38,848,972 I286K probably damaging Het
Olfr951 T C 9: 39,394,222 Y144H probably benign Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T A 18: 80,079,825 F25I probably damaging Het
Parp6 C A 9: 59,633,538 C291* probably null Het
Perm1 C T 4: 156,218,531 R511* probably null Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Pole T A 5: 110,297,430 L481Q probably damaging Het
Polr2i T C 7: 30,233,068 C67R probably damaging Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgfrn T C 3: 101,056,442 N618S possibly damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rims1 C T 1: 22,346,529 probably null Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rsph4a T C 10: 33,911,636 I596T probably damaging Het
Ryr2 A T 13: 11,700,371 Y2770* probably null Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Sertad4 T C 1: 192,847,032 T159A probably benign Het
Setd1a T A 7: 127,785,124 Y382* probably null Het
Sfswap T A 5: 129,513,240 V267E possibly damaging Het
Shank1 T A 7: 44,352,737 D1293E possibly damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc4a4 T A 5: 89,132,414 L366Q probably damaging Het
Sorcs1 T C 19: 50,228,309 probably null Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Svep1 T A 4: 58,073,333 Y1992F probably benign Het
Syce1l A G 8: 113,654,834 R152G possibly damaging Het
Tbc1d17 A C 7: 44,845,131 S227A probably damaging Het
Telo2 A T 17: 25,102,738 probably null Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tmem143 G A 7: 45,907,002 D144N possibly damaging Het
Tmprss11a T A 5: 86,420,032 I279F probably damaging Het
Tnc A G 4: 64,018,096 L201P probably damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn A G 2: 76,788,901 probably null Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Unc80 G A 1: 66,683,273 M3015I probably benign Het
Usp9y A T Y: 1,367,093 V998D probably benign Het
Utrn A G 10: 12,463,339 F2858S probably damaging Het
Vmn1r224 T C 17: 20,419,185 I8T probably benign Het
Vmn2r107 T C 17: 20,356,513 S258P possibly damaging Het
Wars A C 12: 108,875,741 F160C probably damaging Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp28 A T 7: 6,394,792 Y742F probably damaging Het
Zfp541 A G 7: 16,077,973 T184A probably damaging Het
Zfp623 T C 15: 75,947,911 S239P probably damaging Het
Zfp804b T C 5: 6,771,938 D375G probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Etnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1123:Etnk2 UTSW 1 133373272 missense probably benign 0.00
R1551:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R1595:Etnk2 UTSW 1 133373179 missense possibly damaging 0.88
R1728:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1728:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1728:Etnk2 UTSW 1 133365816 nonsense probably null
R1728:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1728:Etnk2 UTSW 1 133376915 missense probably benign
R1729:Etnk2 UTSW 1 133363923 missense probably benign
R1729:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1729:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1729:Etnk2 UTSW 1 133365816 nonsense probably null
R1729:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1729:Etnk2 UTSW 1 133376915 missense probably benign
R1730:Etnk2 UTSW 1 133363923 missense probably benign
R1730:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1730:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1730:Etnk2 UTSW 1 133365816 nonsense probably null
R1730:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1730:Etnk2 UTSW 1 133376915 missense probably benign
R1739:Etnk2 UTSW 1 133363923 missense probably benign
R1739:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1739:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1739:Etnk2 UTSW 1 133365816 nonsense probably null
R1739:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1739:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1762:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1762:Etnk2 UTSW 1 133365816 nonsense probably null
R1762:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1762:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1783:Etnk2 UTSW 1 133363923 missense probably benign
R1783:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1783:Etnk2 UTSW 1 133365816 nonsense probably null
R1783:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1783:Etnk2 UTSW 1 133376915 missense probably benign
R1783:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1784:Etnk2 UTSW 1 133363890 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1784:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1784:Etnk2 UTSW 1 133365816 nonsense probably null
R1784:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133376915 missense probably benign
R1784:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1785:Etnk2 UTSW 1 133363923 missense probably benign
R1785:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1785:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1785:Etnk2 UTSW 1 133365816 nonsense probably null
R1785:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1785:Etnk2 UTSW 1 133376915 missense probably benign
R2089:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R5141:Etnk2 UTSW 1 133368862 missense probably benign 0.01
R5418:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R5586:Etnk2 UTSW 1 133379305 splice site probably null
R5922:Etnk2 UTSW 1 133363885 unclassified probably null
X0025:Etnk2 UTSW 1 133373239 missense probably damaging 1.00
X0026:Etnk2 UTSW 1 133365670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGCCCTTGCCTGCCTTAATG -3'
(R):5'- TCGTAGCACAGCCCGTTCTGAAAG -3'

Sequencing Primer
(F):5'- CTAGATAGCATGGCCTGGAC -3'
(R):5'- CCCGTTCTGAAAGGTACAGTAG -3'
Posted On2014-05-23