Incidental Mutation 'R0078:Gstz1'
ID19566
Institutional Source Beutler Lab
Gene Symbol Gstz1
Ensembl Gene ENSMUSG00000021033
Gene Nameglutathione transferase zeta 1 (maleylacetoacetate isomerase)
Synonymsmaleylacetoacetate isomerase
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87147165-87164723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87159703 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 66 (I66F)
Ref Sequence ENSEMBL: ENSMUSP00000152707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063117] [ENSMUST00000220574] [ENSMUST00000222222] [ENSMUST00000222885]
Predicted Effect probably benign
Transcript: ENSMUST00000063117
AA Change: I67F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000053540
Gene: ENSMUSG00000021033
AA Change: I67F

DomainStartEndE-ValueType
Pfam:GST_N 5 81 4.3e-19 PFAM
Pfam:GST_N_3 8 93 1.2e-18 PFAM
Pfam:GST_N_2 13 82 3.9e-17 PFAM
Pfam:GST_C 99 197 2.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220468
Predicted Effect probably benign
Transcript: ENSMUST00000220574
AA Change: I12F

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221468
Predicted Effect probably benign
Transcript: ENSMUST00000222222
AA Change: I66F

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000222885
AA Change: I12F

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. This enzyme catalyzes the conversion of maleylacetoacetate to fumarylacetoacatate, which is one of the steps in the phenylalanine/tyrosine degradation pathway. Deficiency of a similar gene in mouse causes oxidative stress. Several transcript variants of this gene encode multiple protein isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have essentially normal phenotypes but do display ketoaciduria and severe sensitivity to diets high in tyrosine or phenylalanine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Gstz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Gstz1 APN 12 87163801 missense probably damaging 1.00
IGL02090:Gstz1 APN 12 87163754 missense probably benign
R0592:Gstz1 UTSW 12 87163721 missense probably benign
R3429:Gstz1 UTSW 12 87163696 splice site probably null
R4673:Gstz1 UTSW 12 87162063 missense probably benign 0.08
R4706:Gstz1 UTSW 12 87159120 missense probably benign 0.00
R6026:Gstz1 UTSW 12 87160174 missense probably damaging 0.99
R6938:Gstz1 UTSW 12 87147169 critical splice donor site probably null
X0019:Gstz1 UTSW 12 87159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACCTGGTGACCACAGTAAAG -3'
(R):5'- GCTGTTCAGAGGGAACATTGAGGC -3'

Sequencing Primer
(F):5'- GATACTGCCTGGATTCCCTAGAAG -3'
(R):5'- AGCACTATAAAGGTCCTTTGGG -3'
Posted On2013-04-11