Incidental Mutation 'R1783:Crb1'
ID195673
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission 039814-MU
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1783 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139242995 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 886 (G886R)
Ref Sequence ENSEMBL: ENSMUSP00000142552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445]
Predicted Effect probably damaging
Transcript: ENSMUST00000059825
AA Change: G886R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: G886R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196402
SMART Domains Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198445
AA Change: G825R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: G825R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199291
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 222 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T A 4: 103,231,089 T408S probably damaging Het
4930590J08Rik T C 6: 91,919,278 I369T possibly damaging Het
Abhd17a T A 10: 80,584,026 I115F probably benign Het
Acacb TGGGG TGGG 5: 114,209,767 probably null Het
Adgrb2 C T 4: 130,009,305 T621I possibly damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Bbs9 T C 9: 22,659,119 V587A possibly damaging Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1s T C 1: 136,118,716 F1763S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn8 T C 1: 182,598,822 S241P probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep350 A C 1: 155,928,865 L824R probably damaging Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Chit1 A G 1: 134,149,394 R312G possibly damaging Het
Chit1 G T 1: 134,149,395 R312I probably benign Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Dock10 T G 1: 80,574,180 Y659S probably benign Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dsg2 G A 18: 20,591,880 V448I probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Efnb2 G T 8: 8,623,237 T140K probably damaging Het
En1 A G 1: 120,603,621 S197G unknown Het
Eogt T C 6: 97,113,864 D438G probably damaging Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Etnk2 G T 1: 133,377,046 A336S probably benign Het
Etnppl A G 3: 130,620,749 T98A probably damaging Het
Fam131b T G 6: 42,318,580 Q221P possibly damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fam90a1a A G 8: 21,963,463 N278S probably benign Het
Fbxo40 T A 16: 36,966,222 M662L probably damaging Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Fmo9 A T 1: 166,673,648 F192L probably benign Het
Gabarap C T 11: 69,991,689 probably benign Het
Gatad2a G T 8: 69,909,936 H600N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Git2 T C 5: 114,739,124 E517G probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Glrx2 C T 1: 143,739,740 A27V possibly damaging Het
Gm10961 T C 3: 107,632,994 S37P probably benign Het
Gm13119 G T 4: 144,361,725 E30D probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Gpsm3 G A 17: 34,590,754 R52H possibly damaging Het
Grm7 G C 6: 111,358,295 D556H probably damaging Het
Hdac5 A G 11: 102,200,516 F701L probably benign Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A483S probably benign Het
Ikbke T C 1: 131,269,823 S471G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Irx5 A C 8: 92,359,688 E133A probably damaging Het
Itgb5 C T 16: 33,940,562 T589I probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna5 A T 6: 126,533,860 I435N probably damaging Het
Kcnj5 T C 9: 32,322,192 I276V probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krt2 T C 15: 101,813,973 R426G probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V918I probably benign Het
Lgr6 A T 1: 134,988,009 S611T probably benign Het
Lgr6 G T 1: 134,990,635 H540N probably benign Het
Lgr6 C T 1: 135,003,476 S280N probably benign Het
Lin7b A T 7: 45,369,927 H72Q probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Map3k9 A T 12: 81,722,226 V1016E probably damaging Het
Mcam T C 9: 44,134,706 L6P probably damaging Het
Mgam A G 6: 40,664,860 H549R possibly damaging Het
Miip G A 4: 147,865,774 P122S probably damaging Het
Mkrn1 T A 6: 39,400,456 N346Y probably null Het
Mrc1 T C 2: 14,327,844 V1285A probably benign Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mybpc1 T C 10: 88,570,568 D152G probably damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Myh7b A G 2: 155,625,672 D739G possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Nfkbib A T 7: 28,762,055 Y86N probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrip1 G T 16: 76,292,890 T593K probably benign Het
Obscn A G 11: 59,073,633 Y726H probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1307 T C 2: 111,945,288 H56R probably benign Het
Olfr924 T A 9: 38,848,972 I286K probably damaging Het
Olfr951 T C 9: 39,394,222 Y144H probably benign Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pard6g T A 18: 80,079,825 F25I probably damaging Het
Parp6 C A 9: 59,633,538 C311* probably null Het
Perm1 C T 4: 156,218,531 R511* probably null Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Plekha6 C G 1: 133,287,846 T916S probably benign Het
Pole T A 5: 110,297,430 L481Q probably damaging Het
Polr2i T C 7: 30,233,068 C67R probably damaging Het
Ppfia4 G A 1: 134,299,321 P1159S probably benign Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptgfrn T C 3: 101,056,442 N618S possibly damaging Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 C G 1: 133,350,778 R25G probably null Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rims1 C T 1: 22,346,529 probably null Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep G C 1: 135,283,977 A11G probably benign Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Rsph4a T C 10: 33,911,636 I596T probably damaging Het
Ryr2 A T 13: 11,700,371 Y2770* probably null Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Sertad4 T C 1: 192,847,032 T159A probably benign Het
Setd1a T A 7: 127,785,124 Y382* probably null Het
Sfswap T A 5: 129,513,240 V267E possibly damaging Het
Shank1 T A 7: 44,352,737 D1293E possibly damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc26a9 C A 1: 131,766,012 R747S probably benign Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc4a4 T A 5: 89,132,414 L366Q probably damaging Het
Sorcs1 T C 19: 50,228,309 probably null Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A388V probably benign Het
Svep1 T A 4: 58,073,333 Y1992F probably benign Het
Syce1l A G 8: 113,654,834 R152G possibly damaging Het
Tbc1d17 A C 7: 44,845,131 S227A probably damaging Het
Telo2 A T 17: 25,102,738 probably null Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tmem143 G A 7: 45,907,002 D144N possibly damaging Het
Tmprss11a T A 5: 86,420,032 I279F probably damaging Het
Tnc A G 4: 64,018,096 L201P probably damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn A G 2: 76,788,901 probably null Het
Ttn C T 2: 76,813,339 G13182R probably damaging Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Unc80 G A 1: 66,683,273 M3015I probably benign Het
Usp9y A T Y: 1,367,093 V998D probably benign Het
Utrn A G 10: 12,463,339 F2858S probably damaging Het
Vmn1r224 T C 17: 20,419,185 I8T probably benign Het
Vmn2r107 T C 17: 20,356,513 S258P possibly damaging Het
Wars A C 12: 108,875,741 F160C probably damaging Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfp28 A T 7: 6,394,792 Y742F probably damaging Het
Zfp541 A G 7: 16,077,973 T184A probably damaging Het
Zfp623 T C 15: 75,947,911 S239P probably damaging Het
Zfp804b T C 5: 6,771,938 D375G probably damaging Het
Zp3r A G 1: 130,596,814 L229P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCCATGACTGGTAGGGCATCAGC -3'
(R):5'- TGGTGGCTTACCTGACAGAGAGAAG -3'

Sequencing Primer
(F):5'- ctggaatccctgcccac -3'
(R):5'- GAAGACTGAAGTTTATGGTGGC -3'
Posted On2014-05-23